MYO1G cdna clone
MYO1G cDNA Clone
Gene Names
MYO1G; HA2; MHAG; HLA-HA2
Synonyms
MYO1G; MYO1G cDNA Clone; MYO1G cdna clone
Sequence
atggaggacgaggaaggccctgagtatggcaaacctgactttgtgcttttggaccaagtgaccatggaggacttcatgaggaacctgcagctcaggttcgagaagggccgcatctacacctacatcggtgaggtgctggtgtccgtgaacccctaccaggagctgcccctgtatgggcctgaggccatcgccaggtaccagggccgtgagctctatgagcggccaccccatctctatgctgtggccaacgccgcctacaaggcaatgaagcaccggtccagggacacctgcatcgtcatctcaggggagagtggggcagggaagacagaagccagtaagcacatcatgcagtacatcgctgctgtcaccaatccaagccagagggctgaggtggagagggtcaaggacgtgctgctcaagtccacctgtgtgctggaggcctttggcaatgcccgcaccaaccgcaatcacaactccagccgctttggcaagtacatggacatcaactttgacttcaagggggacccgatcggaggacacatccacagctacctactggagaagtctcgggtcctcaagcagcacgtgggtgaaagaaacttccacgccttctaccaattgctgagaggcagtgaggacaagcagctgcatgaactgcacttggagagaaaccctgctgtatacaatttcacacaccagggagcaggactcaacatgactgtgcacagtgccttggacagtgatgagcagagccaccaggcagtgaccgaggccatgagggtcatcggcttcagtcctgaagaggtggagtctgtgcatcgcatcctggctgccatattgcacctgggaaacatcgagtttgtggagacggaggagggtgggctgcagaaggagggcctggcagtggccgaggaggcactggtggaccatgtggctgagctgacggccacaccccgggacctcgtgctccgctccctgctggctcgcacagttgcctcgggaggcagggaactcatagagaagggccacactgcagctgaggccagctatgcccgggatgcctgtgccaaggcagtgtaccagcggctgtttgagtgggtggtgaacaggatcaacagtgtcatggaaccccggggccgggatcctcggcgtgatggcaaggacacagtcattggcgtgctggacatctatggcttcgaggtgtttcccgtcaacagtttcgagcagttctgcatcaactactgcaatgagaagctgcagcagctattcatccagctcatcctgaagcaggaacaggaagagtacgagcgcgagggcatcacctggcagagcgttgagtatttcaacaacgccaccattgtggatctggtggagcggccccaccgtggcatcctggccgtgctggacgaggcctgcagctctgctggcaccatcactgaccgaatcttcctgcagaccctggacacgcaccaccgccatcatctacactacaccagccgccagctctgccccacagacaagaccatggagtttggccgagacttccggatcaagcactatgcaggggacgtcacgtactccgtggaaggcttcatcgacaagaacagagatttcctcttccaggacttcaagcggctgctgtacaacagcacggaccccactctacgggccatgtggccggacgggcagcaggacatcacagaggtgaccaagcgccccctgacggctggcacactcttcaagaactccatggtggccctggtggagaaccttgcctccaaggagcccttctacgtccgctgcatcaagcccaatgaggacaaggtagctgggaagctggatgagaaccactgtcgccaccaggtcgcatacctggggctgctggagaatgtgagggtccgcagggctggcttcgcttcccgccagccctactctcgattcctgctcaggtacaagatgacctgtgaatacacatggcccaaccacctgctgggctccgacaaggcagccgtgagcgctctcctggagcagcacgggctgcagggggacgtggcctttggccacagcaagctgttcatccgctcaccccggacactggtcacactggagcagagccgagcccgcctcatccccatcattgtgctgctattgcagaaggcatggcggggcaccttggcgaggtggcgctgccggaggctgagggctatctacaccatcatgcgctggttccggagacacaaggtgcgggctcacctggctgagctgcagcggcgattccaggctgcaaggcagccgccactctacgggcgtgaccttgtgtggccgctgccccctgctgtgctgcagcccttccaggacacctgccacgcactcttctgcaggtggcgggcccggcagctggtgaagaacatccccccttcagacatgccccagatcaaggccaaggtggccgccatgggggccctgcaagggcttcgtcaggactggggctgccgacgggcctgggcccgagactacctgtcctctgccactgacaatcccacagcatcaagcctgtttgctcagcgactaaagacacttcgggacaaagatggcttcggggctgtgctcttttcaagccatgtccgcaaggtgaaccgcttccacaagatccggaaccgggccctcctgctcacagaccagcacctctacaagctggaccctgaccggcagtaccgggtgatgcgggccgtgccccttgaggcggtgacggggctgagcgtgaccagcggaggagaccagctggtggtgctgcacgcccgcggccaggacgacctcgtggtgtgcctgcaccgctcccggccgccattggacaaccgcgttggggagctggtgggcgtgctggccgcacactgccagggggagggccgcaccctggaggttcgcgtctccgactgcatcccactaagccatcgcggggtccggcgcctcatctccgtggagcccaggccggagcagccagagcccgatttccgctgcgctcgcggctccttcaccctgctctggcccagccgctga
Sequence Length
3057
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,279 Da
NCBI Official Full Name
Homo sapiens myosin IG, mRNA
NCBI Official Synonym Full Names
myosin IG
NCBI Official Symbol
MYO1G
NCBI Official Synonym Symbols
HA2; MHAG; HLA-HA2
NCBI Protein Information
unconventional myosin-Ig
UniProt Protein Name
Unconventional myosin-Ig
Protein Family
UniProt Gene Name
MYO1G
UniProt Synonym Gene Names
HA2; mHag HA-2
UniProt Entry Name
MYO1G_HUMAN
NCBI Description
MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
Uniprot Description
MYO1G: Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. Their highly divergent tails are presumed to bind to membranous compartments, which would be moved relative to actin filaments. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Contractile; Motor
Chromosomal Location of Human Ortholog: 7p13
Cellular Component: membrane; phagocytic cup; plasma membrane
Molecular Function: phosphatidylinositol-3,4,5-triphosphate binding; phosphatidylinositol-3,4-bisphosphate binding; phosphatidylinositol-4,5-bisphosphate binding
Biological Process: T cell mediated immunity
Research Articles on MYO1G
Similar Products
Product Notes
The MYO1G myo1g (Catalog #AAA1272629) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggacg aggaaggccc tgagtatggc aaacctgact ttgtgctttt ggaccaagtg accatggagg acttcatgag gaacctgcag ctcaggttcg agaagggccg catctacacc tacatcggtg aggtgctggt gtccgtgaac ccctaccagg agctgcccct gtatgggcct gaggccatcg ccaggtacca gggccgtgag ctctatgagc ggccacccca tctctatgct gtggccaacg ccgcctacaa ggcaatgaag caccggtcca gggacacctg catcgtcatc tcaggggaga gtggggcagg gaagacagaa gccagtaagc acatcatgca gtacatcgct gctgtcacca atccaagcca gagggctgag gtggagaggg tcaaggacgt gctgctcaag tccacctgtg tgctggaggc ctttggcaat gcccgcacca accgcaatca caactccagc cgctttggca agtacatgga catcaacttt gacttcaagg gggacccgat cggaggacac atccacagct acctactgga gaagtctcgg gtcctcaagc agcacgtggg tgaaagaaac ttccacgcct tctaccaatt gctgagaggc agtgaggaca agcagctgca tgaactgcac ttggagagaa accctgctgt atacaatttc acacaccagg gagcaggact caacatgact gtgcacagtg ccttggacag tgatgagcag agccaccagg cagtgaccga ggccatgagg gtcatcggct tcagtcctga agaggtggag tctgtgcatc gcatcctggc tgccatattg cacctgggaa acatcgagtt tgtggagacg gaggagggtg ggctgcagaa ggagggcctg gcagtggccg aggaggcact ggtggaccat gtggctgagc tgacggccac accccgggac ctcgtgctcc gctccctgct ggctcgcaca gttgcctcgg gaggcaggga actcatagag aagggccaca ctgcagctga ggccagctat gcccgggatg cctgtgccaa ggcagtgtac cagcggctgt ttgagtgggt ggtgaacagg atcaacagtg tcatggaacc ccggggccgg gatcctcggc gtgatggcaa ggacacagtc attggcgtgc tggacatcta tggcttcgag gtgtttcccg tcaacagttt cgagcagttc tgcatcaact actgcaatga gaagctgcag cagctattca tccagctcat cctgaagcag gaacaggaag agtacgagcg cgagggcatc acctggcaga gcgttgagta tttcaacaac gccaccattg tggatctggt ggagcggccc caccgtggca tcctggccgt gctggacgag gcctgcagct ctgctggcac catcactgac cgaatcttcc tgcagaccct ggacacgcac caccgccatc atctacacta caccagccgc cagctctgcc ccacagacaa gaccatggag tttggccgag acttccggat caagcactat gcaggggacg tcacgtactc cgtggaaggc ttcatcgaca agaacagaga tttcctcttc caggacttca agcggctgct gtacaacagc acggacccca ctctacgggc catgtggccg gacgggcagc aggacatcac agaggtgacc aagcgccccc tgacggctgg cacactcttc aagaactcca tggtggccct ggtggagaac cttgcctcca aggagccctt ctacgtccgc tgcatcaagc ccaatgagga caaggtagct gggaagctgg atgagaacca ctgtcgccac caggtcgcat acctggggct gctggagaat gtgagggtcc gcagggctgg cttcgcttcc cgccagccct actctcgatt cctgctcagg tacaagatga cctgtgaata cacatggccc aaccacctgc tgggctccga caaggcagcc gtgagcgctc tcctggagca gcacgggctg cagggggacg tggcctttgg ccacagcaag ctgttcatcc gctcaccccg gacactggtc acactggagc agagccgagc ccgcctcatc cccatcattg tgctgctatt gcagaaggca tggcggggca ccttggcgag gtggcgctgc cggaggctga gggctatcta caccatcatg cgctggttcc ggagacacaa ggtgcgggct cacctggctg agctgcagcg gcgattccag gctgcaaggc agccgccact ctacgggcgt gaccttgtgt ggccgctgcc ccctgctgtg ctgcagccct tccaggacac ctgccacgca ctcttctgca ggtggcgggc ccggcagctg gtgaagaaca tccccccttc agacatgccc cagatcaagg ccaaggtggc cgccatgggg gccctgcaag ggcttcgtca ggactggggc tgccgacggg cctgggcccg agactacctg tcctctgcca ctgacaatcc cacagcatca agcctgtttg ctcagcgact aaagacactt cgggacaaag atggcttcgg ggctgtgctc ttttcaagcc atgtccgcaa ggtgaaccgc ttccacaaga tccggaaccg ggccctcctg ctcacagacc agcacctcta caagctggac cctgaccggc agtaccgggt gatgcgggcc gtgccccttg aggcggtgac ggggctgagc gtgaccagcg gaggagacca gctggtggtg ctgcacgccc gcggccagga cgacctcgtg gtgtgcctgc accgctcccg gccgccattg gacaaccgcg ttggggagct ggtgggcgtg ctggccgcac actgccaggg ggagggccgc accctggagg ttcgcgtctc cgactgcatc ccactaagcc atcgcggggt ccggcgcctc atctccgtgg agcccaggcc ggagcagcca gagcccgatt tccgctgcgc tcgcggctcc ttcaccctgc tctggcccag ccgctga. It is sometimes possible for the material contained within the vial of "MYO1G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
