Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYO15B cdna clone

MYO15B cDNA Clone

Gene Names
MYO15B; MYO15BP
Synonyms
MYO15B; MYO15B cDNA Clone; MYO15B cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggaattcgcccggcgttacttccggaggtcccaggccttgctgggccagactgatggaggtgccgcaggaaaggacacggacagcctggtgcagtacaccaaggctcccatccaggagtcgctcctcagcctcagtgatgatgtgagcaagctggctgtagccagcttcctggccctgatgcggtttatgggtgaccagtccaagccccggggcaaggatgagatggatctgctctatgaactgctgaagctgtgccagcaggagaagctgagggatgagatttactgccaggttatcaagcaggtcacgggacacccccggccggaacactgcactcgaggctggagcttcctcagccttctcacaggcttcttccccccgtcgaccaggctgatgccctacctgaccaagtttctgcaggattcaggccccagccaagagctggcccggagcagccaggagcacctccagcgcacagtcaaatatggggggcgccggcggatgcccccaccgggtgaaatgaaggctttcctgaaaggacaagcgattcgcctgcttcttattcacctgccggggggtgtggattataggacgaatatccagactttcacagtagcagcagaagtgcaggaggagctgtgccggcaaatgggtatcacggagcctcaggaagtgcaggaattcgccctcttcctcatcaaagagaagagccagctggtgcggcccctgcagcccgccgaatacctcagcagcgtggtagtggaccaggacgtgagcctgcacagccggcggctccactgggagaccccactgcacttcgataactccacctacatcagcacccactacagccaggtgctgtgggactaccttcaggggaagctgccagtcagcgccaaggcagacgcgcagctcgccaggctggccgccctgcagcacctcagcaaggccaacaggaataccccctcagggcaggacctgctagcttacgtgccaaagcagctgcaacggcaggtgaacacggcctccatcaagaacctgatgggtcaggagctgagacggctggaaggacacagcccccaggaagcacagatcagcttcattgaggccatgagccagctgcccctcttcggctacaccgtctatggggtgctgcgagtgagcatgcaggccctgtccggacccactctcctggggctcaaccgccagcatctcatcctcatggaccccagctcccagagcctgtactgccgcattgccctgaagagcctgcagcggctccacctgctaagccctctggaggagaaggggccccctggcctggaagtcaactatggctcagctgacaacccccagaccatctggtttgagctgccacaggcccaggagctgctatacaccactgtcttcctgatagacagcagtgcctcttgcactgagtggcccagcatcaactga
Sequence Length
1464
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens myosin XVB pseudogene, mRNA
NCBI Official Synonym Full Names
myosin XVB
NCBI Official Symbol
MYO15B
NCBI Official Synonym Symbols
MYO15BP
NCBI Protein Information
myosin XVB
Protein Family

Research Articles on MYO15B

Similar Products

Product Notes

The MYO15B (Catalog #AAA1266447) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggaat tcgcccggcg ttacttccgg aggtcccagg ccttgctggg ccagactgat ggaggtgccg caggaaagga cacggacagc ctggtgcagt acaccaaggc tcccatccag gagtcgctcc tcagcctcag tgatgatgtg agcaagctgg ctgtagccag cttcctggcc ctgatgcggt ttatgggtga ccagtccaag ccccggggca aggatgagat ggatctgctc tatgaactgc tgaagctgtg ccagcaggag aagctgaggg atgagattta ctgccaggtt atcaagcagg tcacgggaca cccccggccg gaacactgca ctcgaggctg gagcttcctc agccttctca caggcttctt ccccccgtcg accaggctga tgccctacct gaccaagttt ctgcaggatt caggccccag ccaagagctg gcccggagca gccaggagca cctccagcgc acagtcaaat atggggggcg ccggcggatg cccccaccgg gtgaaatgaa ggctttcctg aaaggacaag cgattcgcct gcttcttatt cacctgccgg ggggtgtgga ttataggacg aatatccaga ctttcacagt agcagcagaa gtgcaggagg agctgtgccg gcaaatgggt atcacggagc ctcaggaagt gcaggaattc gccctcttcc tcatcaaaga gaagagccag ctggtgcggc ccctgcagcc cgccgaatac ctcagcagcg tggtagtgga ccaggacgtg agcctgcaca gccggcggct ccactgggag accccactgc acttcgataa ctccacctac atcagcaccc actacagcca ggtgctgtgg gactaccttc aggggaagct gccagtcagc gccaaggcag acgcgcagct cgccaggctg gccgccctgc agcacctcag caaggccaac aggaataccc cctcagggca ggacctgcta gcttacgtgc caaagcagct gcaacggcag gtgaacacgg cctccatcaa gaacctgatg ggtcaggagc tgagacggct ggaaggacac agcccccagg aagcacagat cagcttcatt gaggccatga gccagctgcc cctcttcggc tacaccgtct atggggtgct gcgagtgagc atgcaggccc tgtccggacc cactctcctg gggctcaacc gccagcatct catcctcatg gaccccagct cccagagcct gtactgccgc attgccctga agagcctgca gcggctccac ctgctaagcc ctctggagga gaaggggccc cctggcctgg aagtcaacta tggctcagct gacaaccccc agaccatctg gtttgagctg ccacaggccc aggagctgct atacaccact gtcttcctga tagacagcag tgcctcttgc actgagtggc ccagcatcaa ctga. It is sometimes possible for the material contained within the vial of "MYO15B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.