Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYLIP cdna clone

MYLIP cDNA Clone

Gene Names
MYLIP; MIR; IDOL
Synonyms
MYLIP; MYLIP cDNA Clone; MYLIP cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtgttatgtgacgaggccggacgcggtgctgatggaggtggaggtggaggcgaaagccaacggcgaggactgcctcaaccaggtgtgcaggcgactgggaatcatagaagttgactattttggactgcagtttacgggtagcaaaggtgaaagtttatggctaaacctgagaaaccggatctcccagcagatggatgggctagccccttacaggcttaaacttagagtcaagttcttcgtggagcctcatctcatcttacaggagcagactaggcatatctttttcttgcacatcaaggaggccctcttggcaggccacctcttgtgttccccagagcaggcagtggaactcagtgccctcctggcccagaccaagtttggagactacaaccagaacactgccaagtataactatgaggagctctgtgccaaggagctctcctctgccaccttgaacagcattgttgcaaaacataaggagttggaggggaccagccaggcttcagctgaataccaagttttgcagattgtgtcggcaatggaaaactatggcatagaatggcattctgtgcgggatagcgaagggcagaaactgctcattggggttggacctgaaggaatctcaatttgtaaagatgactttagcccaattaataggatagcttatcctgtggtgcagatggccacccagtcaggaaagaatgtatatttgacggtcaccaaggaatctgggaacagcatcgtgctcttgtttaaaatgatcagcaccagggcggccagcgggctctaccgagcgataacagagacgcacgcattctacaggtgtgacacagtgaccagcgccgtgatgatgcagtatagccgtgacttgaagggccacttggcatctctgtttctgaatgaaaacattaaccttggcaagaaatatgtctttgatattaaaagaacatcaaaggaggtgtatgaccatgccaggagggctctgtacaatgctggcgttgtggacctcgtttcaagaaacaaccagagcccttcacactcgcctctgaagtcctcagaaagcagcatgaactgcagcagctgcgagggcctcagctgccagcagacccgggtgctgcaggagaagctacgcaagctgaaggaagccatgctgtgcatggtgtgctgcgaggaggagatcaactccaccttctgtccctgtggccacactgtgtgctgtgagagctgcgccgcccagctacagtcatgtcccgtctgcaggtcgcgtgtggagcatgtccagcacgtctatctgccaacgcacaccagtcttctcaatctgactgtaatctaa
Sequence Length
1338
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,989 Da
NCBI Official Full Name
Homo sapiens myosin regulatory light chain interacting protein, mRNA
NCBI Official Synonym Full Names
myosin regulatory light chain interacting protein
NCBI Official Symbol
MYLIP
NCBI Official Synonym Symbols
MIR; IDOL
NCBI Protein Information
E3 ubiquitin-protein ligase MYLIP
UniProt Protein Name
E3 ubiquitin-protein ligase MYLIP
UniProt Gene Name
MYLIP
UniProt Synonym Gene Names
BZF1; IDOL; Idol; MIR
UniProt Entry Name
MYLIP_HUMAN

NCBI Description

The ERM protein family members ezrin, radixin, and moesin are cytoskeletal effector proteins linking actin to membrane-bound proteins at the cell surface. Myosin regulatory light chain interacting protein (MYLIP) is a novel ERM-like protein that interacts with myosin regulatory light chain and inhibits neurite outgrowth. [provided by RefSeq, Jul 2008]

Uniprot Description

MYLIP: E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of myosin regulatory light chain (MRLC), LDLR, VLDLR and LRP8. Activity depends on E2 enzymes of the UBE2D family. Proteasomal degradation of MRLC leads to inhibit neurite outgrowth in presence of NGF by counteracting the stabilization of MRLC by saposin-like protein (CNPY2/MSAP) and reducing CNPY2-stimulated neurite outgrowth. Acts as a sterol- dependent inhibitor of cellular cholesterol uptake by mediating ubiquitination and subsequent degradation of LDLR. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; EC 6.3.2.19; Ligase; Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 6p22.3

Cellular Component: cytosol; intracellular

Molecular Function: cytoskeletal protein binding; protein binding; ubiquitin-protein ligase activity

Biological Process: cell motility; nervous system development; protein polyubiquitination; protein ubiquitination

Research Articles on MYLIP

Similar Products

Product Notes

The MYLIP mylip (Catalog #AAA1277618) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtgtt atgtgacgag gccggacgcg gtgctgatgg aggtggaggt ggaggcgaaa gccaacggcg aggactgcct caaccaggtg tgcaggcgac tgggaatcat agaagttgac tattttggac tgcagtttac gggtagcaaa ggtgaaagtt tatggctaaa cctgagaaac cggatctccc agcagatgga tgggctagcc ccttacaggc ttaaacttag agtcaagttc ttcgtggagc ctcatctcat cttacaggag cagactaggc atatcttttt cttgcacatc aaggaggccc tcttggcagg ccacctcttg tgttccccag agcaggcagt ggaactcagt gccctcctgg cccagaccaa gtttggagac tacaaccaga acactgccaa gtataactat gaggagctct gtgccaagga gctctcctct gccaccttga acagcattgt tgcaaaacat aaggagttgg aggggaccag ccaggcttca gctgaatacc aagttttgca gattgtgtcg gcaatggaaa actatggcat agaatggcat tctgtgcggg atagcgaagg gcagaaactg ctcattgggg ttggacctga aggaatctca atttgtaaag atgactttag cccaattaat aggatagctt atcctgtggt gcagatggcc acccagtcag gaaagaatgt atatttgacg gtcaccaagg aatctgggaa cagcatcgtg ctcttgttta aaatgatcag caccagggcg gccagcgggc tctaccgagc gataacagag acgcacgcat tctacaggtg tgacacagtg accagcgccg tgatgatgca gtatagccgt gacttgaagg gccacttggc atctctgttt ctgaatgaaa acattaacct tggcaagaaa tatgtctttg atattaaaag aacatcaaag gaggtgtatg accatgccag gagggctctg tacaatgctg gcgttgtgga cctcgtttca agaaacaacc agagcccttc acactcgcct ctgaagtcct cagaaagcag catgaactgc agcagctgcg agggcctcag ctgccagcag acccgggtgc tgcaggagaa gctacgcaag ctgaaggaag ccatgctgtg catggtgtgc tgcgaggagg agatcaactc caccttctgt ccctgtggcc acactgtgtg ctgtgagagc tgcgccgccc agctacagtc atgtcccgtc tgcaggtcgc gtgtggagca tgtccagcac gtctatctgc caacgcacac cagtcttctc aatctgactg taatctaa. It is sometimes possible for the material contained within the vial of "MYLIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.