MYBPHL cdna clone
MYBPHL cDNA Clone
Synonyms
MYBPHL; MYBPHL cDNA Clone; MYBPHL cdna clone
Sequence
atggaggcagccacagctccggaggtggccgcaggatccaagctgaaggtgaaagaagccagcccagcggatgctgaaccaccccaggcttcacctggacagggggctggcagccccactccccagctcctgccccctatagaagagcaccccaagatctggctacctcgggccctgaggcagacctacatccggaaggttggggacacagtgaacctactaatcccattccagggcaagcccaaacctcaagccatctggacacatgatggctgtgccttggacaccaggcgtgtgagtgtgcggaatggggagcaagactccatcctcttcatccgagaagcccaacgtgctgactcaggtcgctaccaactccgcgtgcagctgggtgggctggaggccaccgccaccattgacatcctggtgattgagaggccaggccctcctcagagtattaagctggtggacgtttggggcttcagcgctacactggaatggacaccgccccaagatacggggaatacagcacttctgggatacacggtgcagaaggctgacacaaaatccgggctgtggttcacggtgctggagcactatcaccgcaccagctgcatcgtctctgacctcatcatcggcaactcctatgccttccgtgtctttgctgaaaaccagtgcggactcagtgaaacagcccccatcaccacggacctcgcccacatccagaaagcagctactgtttacaagaccaaggggtttgcccaacgagacttctctgaagccccaaagtttacccagcctctggccaactgcactacagtcaccggctataatacccagctcttctgctgtgtccgcgcctctccccggcccaagatcatctggctgaagaacaagatggatatccaaggcaaccctaagtacagagccctgactcacctgggaatctgctccctagagatccgcaagccgggtccctttgatggaggcatctatacttgcaaggcggtgaaccccctaggggaggcatctgtggactgtcgggtggatgtgaaagttcctaattga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,251 Da
NCBI Official Full Name
Homo sapiens myosin binding protein H-like, mRNA
NCBI Official Synonym Full Names
myosin binding protein H like
NCBI Official Symbol
MYBPHL
NCBI Protein Information
myosin-binding protein H-like
UniProt Protein Name
Myosin-binding protein H-like
Protein Family
UniProt Gene Name
MYBPHL
UniProt Entry Name
MBPHL_HUMAN
NCBI Description
This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Uniprot Description
MYBPHL: a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 1p13.3
Molecular Function: protein binding
Similar Products
Product Notes
The MYBPHL mybphl (Catalog #AAA1266302) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcag ccacagctcc ggaggtggcc gcaggatcca agctgaaggt gaaagaagcc agcccagcgg atgctgaacc accccaggct tcacctggac agggggctgg cagccccact ccccagctcc tgccccctat agaagagcac cccaagatct ggctacctcg ggccctgagg cagacctaca tccggaaggt tggggacaca gtgaacctac taatcccatt ccagggcaag cccaaacctc aagccatctg gacacatgat ggctgtgcct tggacaccag gcgtgtgagt gtgcggaatg gggagcaaga ctccatcctc ttcatccgag aagcccaacg tgctgactca ggtcgctacc aactccgcgt gcagctgggt gggctggagg ccaccgccac cattgacatc ctggtgattg agaggccagg ccctcctcag agtattaagc tggtggacgt ttggggcttc agcgctacac tggaatggac accgccccaa gatacgggga atacagcact tctgggatac acggtgcaga aggctgacac aaaatccggg ctgtggttca cggtgctgga gcactatcac cgcaccagct gcatcgtctc tgacctcatc atcggcaact cctatgcctt ccgtgtcttt gctgaaaacc agtgcggact cagtgaaaca gcccccatca ccacggacct cgcccacatc cagaaagcag ctactgttta caagaccaag gggtttgccc aacgagactt ctctgaagcc ccaaagttta cccagcctct ggccaactgc actacagtca ccggctataa tacccagctc ttctgctgtg tccgcgcctc tccccggccc aagatcatct ggctgaagaa caagatggat atccaaggca accctaagta cagagccctg actcacctgg gaatctgctc cctagagatc cgcaagccgg gtccctttga tggaggcatc tatacttgca aggcggtgaa ccccctaggg gaggcatctg tggactgtcg ggtggatgtg aaagttccta attga. It is sometimes possible for the material contained within the vial of "MYBPHL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
