MYADM cdna clone
MYADM cDNA Clone
Gene Names
MYADM; SB135
Synonyms
MYADM; MYADM cDNA Clone; MYADM cdna clone
Sequence
atgccagtgacggtaacccgcaccaccatcacaaccaccacgacgtcatcttcgggcctggggtcccccatgatcgtggggtcccctcgggccctgacacagcccctgggtctccttcgcctgctgcagctggtgtctacctgcgtggccttctcgctggtggctagcgtgggcgcctggacggggtccatgggcaactggtccatgttcacctggtgcttctgcttctccgtgaccctgatcatcctcatcgtggagctgtgcgggctccaggcccgcttccccctgtcttggcgcaacttccccatcaccttcgcctgctatgcggccctcttctgcctctcggcctccatcatctaccccaccacctatgtccagttcctgtcccacggccgttcgcgggaccacgccatcgccgccaccttcttctcctgcatcgcgtgtgtggcttacgccaccgaagtggcctggacccgggcccggcccggcgagatcactggctatatggccaccgtacccgggctgctgaaggtgctggagaccttcgttgcctgcatcatcttcgcgttcatcagcgaccccaacctgtaccagcaccagccggccctggagtggtgcgtggcggtgtacgccatctgcttcatcctagcggccatcgccatcctgctgaacctgggggagtgcaccaacgtgctacccatccccttccccagcttcctgtcggggctggccttgctgtctgtcctcctctatgccaccgcccttgttctctggcccctctaccagttcgatgagaagtatggcggccagcctcggcgctcgagagatgtaagctgcagccgcagccatgcctactacgtgtgtgcctgggaccgccgactggctgtggccatcctgacggccatcaacctactggcgtatgtggctgacctggtgcactctgcccacctggtttttgtcaaggtctaa
Sequence Length
969
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,274 Da
NCBI Official Full Name
Homo sapiens myeloid-associated differentiation marker, mRNA
NCBI Official Synonym Full Names
myeloid associated differentiation marker
NCBI Official Symbol
MYADM
NCBI Official Synonym Symbols
SB135
NCBI Protein Information
myeloid-associated differentiation marker
UniProt Protein Name
Myeloid-associated differentiation marker
Protein Family
UniProt Gene Name
MYADM
UniProt Entry Name
MYADM_HUMAN
Uniprot Description
MYADM: Belongs to the MAL family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 19q13.42
Cellular Component: cortical actin cytoskeleton; intercellular junction; lipid raft; plasma membrane; ruffle
Biological Process: intercellular junction maintenance; lipid raft organization and biogenesis; negative regulation of actin filament polymerization; negative regulation of heterotypic cell-cell adhesion; negative regulation of protein amino acid phosphorylation; positive regulation of cell migration
Research Articles on MYADM
1. MYADM controls endothelial barrier function through ERM-dependent regulation of ICAM-1 expression.
Similar Products
Product Notes
The MYADM myadm (Catalog #AAA1270156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagtga cggtaacccg caccaccatc acaaccacca cgacgtcatc ttcgggcctg gggtccccca tgatcgtggg gtcccctcgg gccctgacac agcccctggg tctccttcgc ctgctgcagc tggtgtctac ctgcgtggcc ttctcgctgg tggctagcgt gggcgcctgg acggggtcca tgggcaactg gtccatgttc acctggtgct tctgcttctc cgtgaccctg atcatcctca tcgtggagct gtgcgggctc caggcccgct tccccctgtc ttggcgcaac ttccccatca ccttcgcctg ctatgcggcc ctcttctgcc tctcggcctc catcatctac cccaccacct atgtccagtt cctgtcccac ggccgttcgc gggaccacgc catcgccgcc accttcttct cctgcatcgc gtgtgtggct tacgccaccg aagtggcctg gacccgggcc cggcccggcg agatcactgg ctatatggcc accgtacccg ggctgctgaa ggtgctggag accttcgttg cctgcatcat cttcgcgttc atcagcgacc ccaacctgta ccagcaccag ccggccctgg agtggtgcgt ggcggtgtac gccatctgct tcatcctagc ggccatcgcc atcctgctga acctggggga gtgcaccaac gtgctaccca tccccttccc cagcttcctg tcggggctgg ccttgctgtc tgtcctcctc tatgccaccg cccttgttct ctggcccctc taccagttcg atgagaagta tggcggccag cctcggcgct cgagagatgt aagctgcagc cgcagccatg cctactacgt gtgtgcctgg gaccgccgac tggctgtggc catcctgacg gccatcaacc tactggcgta tgtggctgac ctggtgcact ctgcccacct ggtttttgtc aaggtctaa. It is sometimes possible for the material contained within the vial of "MYADM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
