Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MXD3 cdna clone

MXD3 cDNA Clone

Gene Names
MXD3; MYX; MAD3; BHLHC13
Synonyms
MXD3; MXD3 cDNA Clone; MXD3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaacccttggccagcaacatccaggtcctgctgcaggcggccgagttcctggagcgccgtgagagagaggccgagcatggttatgcgtccctgtgcccgcatcgcagtccaggccccatccacaggaggaagaagcgacccccccaggctcctggcgcgcaggacagcgggcggtcagtgcacaatgaactggagaagcgcaggagggcccagttgaagcggtgcctggagcggctgaagcagcagatgcccctgggggccgactgtgcccggtacaccacgctgagcctgctgcgccgtgccaggatgcacatccagaagctggaggatcaggagcagcgggcccgacagctcaaggagaggctgcgcagcaagcagcagagcctgcagcggcagctggagcagctccgggggctggcaggggcggccgagcgggagcggctgcgggcggacagtctggactcctcaggcctctcctctgagcgctcagactcagaccaagaggagctggaggtggatgtggagagcctggtgtttgggggtgaggccgagctgctgcggggcttcgtcgccggccaggagcacagctactcgcacggcggcggcgcctggctatga
Sequence Length
621
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,821 Da
NCBI Official Full Name
Homo sapiens MAX dimerization protein 3, mRNA
NCBI Official Synonym Full Names
MAX dimerization protein 3
NCBI Official Symbol
MXD3
NCBI Official Synonym Symbols
MYX; MAD3; BHLHC13
NCBI Protein Information
max dimerization protein 3
UniProt Protein Name
Max dimerization protein 3
Protein Family
UniProt Gene Name
MXD3
UniProt Synonym Gene Names
BHLHC13; MAD3; Max dimerizer 3; bHLHc13
UniProt Entry Name
MAD3_HUMAN

NCBI Description

This gene encodes a member of the Myc superfamily of basic helix-loop-helix leucine zipper transcriptional regulators. The encoded protein forms a heterodimer with the cofactor MAX which binds specific E-box DNA motifs in the promoters of target genes and regulates their transcription. Disruption of the MAX-MXD3 complex is associated with uncontrolled cell proliferation and tumorigenesis. Transcript variants of this gene encoding different isoforms have been described.[provided by RefSeq, Dec 2008]

Uniprot Description

MXD3: Transcriptional repressor. Binds with MAX to form a sequence-specific DNA-binding protein complex which recognizes the core sequence 5'-CAC[GA]TG-3'. Antagonizes MYC transcriptional activity by competing for MAX and suppresses MYC dependent cell transformation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 5q35.3

Molecular Function: protein binding

Research Articles on MXD3

Similar Products

Product Notes

The MXD3 mxd3 (Catalog #AAA1273464) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaccct tggccagcaa catccaggtc ctgctgcagg cggccgagtt cctggagcgc cgtgagagag aggccgagca tggttatgcg tccctgtgcc cgcatcgcag tccaggcccc atccacagga ggaagaagcg acccccccag gctcctggcg cgcaggacag cgggcggtca gtgcacaatg aactggagaa gcgcaggagg gcccagttga agcggtgcct ggagcggctg aagcagcaga tgcccctggg ggccgactgt gcccggtaca ccacgctgag cctgctgcgc cgtgccagga tgcacatcca gaagctggag gatcaggagc agcgggcccg acagctcaag gagaggctgc gcagcaagca gcagagcctg cagcggcagc tggagcagct ccgggggctg gcaggggcgg ccgagcggga gcggctgcgg gcggacagtc tggactcctc aggcctctcc tctgagcgct cagactcaga ccaagaggag ctggaggtgg atgtggagag cctggtgttt gggggtgagg ccgagctgct gcggggcttc gtcgccggcc aggagcacag ctactcgcac ggcggcggcg cctggctatg a. It is sometimes possible for the material contained within the vial of "MXD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.