Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MUC7 cdna clone

MUC7 cDNA Clone

Gene Names
MUC7; MG2
Synonyms
MUC7; MUC7 cDNA Clone; MUC7 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttcattagaaagtcctataaatgtctgcacaaacgctgtaggcctaagcttccaccttcacctaataacccccccaaattcccaaatcctcaccagccacctaaacatccagataaaaatagcagtgtggtcaaccctaccttagtggctacaacccaaattccatctgtgactttcccatcagcttccaccaaaattactacccttccaaatgtgacttttcttccccagaatgccaccaccatatcttcaagagaaaatgttaacacaagctcttctgtagctacattagcaccagtgaattccccagctccacaagacaccacagctgccccacccacaccttctgcaactacaccagctccaccatcttcctcagctccaccagagaccacagctgccccacccacaccttctgcaactacacaagctccaccatcttcctcagctccaccagagaccacagctgccccacccacacctcctgcaactacaccagctccaccatcttcctcagctccaccagagaccacagctgccccacccacaccttctgcaactacaccagctccactatcttcctcagctccaccagagaccacagctgtcccacccacaccttctgcaactaccctagacccatcatccgcctcagctccaccagagaccacagctgccccacccacaccttctgcaactacaccagctccaccgtcttccccagctccacaagagaccacagctgccccaattaccacacctaattcttccccaactactcttgcacctgacacttctgaaacttcagctgcacccacacaccagactattacttcggtcactactcaaactactactactaaacaaccaacttcagctcctggccaaaataaaatttctcgatttcttttatatatgaagaatctactaaacagaattattgacgacatggtggagcaatag
Sequence Length
1134
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,159 Da
NCBI Official Full Name
Homo sapiens mucin 7, secreted, mRNA
NCBI Official Synonym Full Names
mucin 7, secreted
NCBI Official Symbol
MUC7
NCBI Official Synonym Symbols
MG2
NCBI Protein Information
mucin-7
UniProt Protein Name
Mucin-7
Protein Family
UniProt Gene Name
MUC7
UniProt Synonym Gene Names
MG2; MUC-7
UniProt Entry Name
MUC7_HUMAN

NCBI Description

This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Oct 2014]

Uniprot Description

MUC7: May function in a protective capacity by promoting the clearance of bacteria in the oral cavity and aiding in mastication, speech, and swallowing. Binds P.aeruginosa pili. Genetic variations in MUC7 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: Golgi lumen

Molecular Function: protein binding

Biological Process: O-glycan processing

Disease: Asthma, Susceptibility To

Research Articles on MUC7

Similar Products

Product Notes

The MUC7 muc7 (Catalog #AAA1278463) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaactc tgccgctgtt tgtgtgcatc tgtgcactga gtgcttgctt ctcgttcagt gaaggtcgag aaagggatca tgaactacgt cacagaaggc atcatcacca atcacccaaa tctcactttg aattaccaca ttatcctgga ctgctagctc accagaagcc gttcattaga aagtcctata aatgtctgca caaacgctgt aggcctaagc ttccaccttc acctaataac ccccccaaat tcccaaatcc tcaccagcca cctaaacatc cagataaaaa tagcagtgtg gtcaacccta ccttagtggc tacaacccaa attccatctg tgactttccc atcagcttcc accaaaatta ctacccttcc aaatgtgact tttcttcccc agaatgccac caccatatct tcaagagaaa atgttaacac aagctcttct gtagctacat tagcaccagt gaattcccca gctccacaag acaccacagc tgccccaccc acaccttctg caactacacc agctccacca tcttcctcag ctccaccaga gaccacagct gccccaccca caccttctgc aactacacaa gctccaccat cttcctcagc tccaccagag accacagctg ccccacccac acctcctgca actacaccag ctccaccatc ttcctcagct ccaccagaga ccacagctgc cccacccaca ccttctgcaa ctacaccagc tccactatct tcctcagctc caccagagac cacagctgtc ccacccacac cttctgcaac taccctagac ccatcatccg cctcagctcc accagagacc acagctgccc cacccacacc ttctgcaact acaccagctc caccgtcttc cccagctcca caagagacca cagctgcccc aattaccaca cctaattctt ccccaactac tcttgcacct gacacttctg aaacttcagc tgcacccaca caccagacta ttacttcggt cactactcaa actactacta ctaaacaacc aacttcagct cctggccaaa ataaaatttc tcgatttctt ttatatatga agaatctact aaacagaatt attgacgaca tggtggagca atag. It is sometimes possible for the material contained within the vial of "MUC7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.