MUC15 cdna clone
MUC15 cDNA Clone
Gene Names
MUC15; PAS3; MUC-15; PASIII
Synonyms
MUC15; MUC15 cDNA Clone; MUC15 cdna clone
Sequence
atgttggccttagccaaaattctgttgatttcaacgttgttttattcacttctatcggggagccatggaaaagaaaatcaagacataaacacaacacagaacattgcagaagtttttaaaacaatggaaaataaacctatttctttggaaagtgaagcaaacttaaactcagataaagaaaatataaccacctcaaatctcaaggcgagtcattcccctcctttgaatctacccaacaacagccacggaataacagatttctccagtaactcgtcagcagagcattctttgggcagtctaaaacccacatctaccatttccacaagccctcccttgatccatagctttgtttctaaagtgccttggaatgcacctatagcagatgaagatcttttgcccatctcagcacatcccaatgctacacctgctctgtcttcagaaaacttcacttggtctttggtcaatgacaccgtgaaaactcctgataacagttccattacagttagcatcctctcttcagaaccaacttctccatctgtgacccccttgatagtggaaccaagtggatggcttaccacaaacagtgatagcttcactgggtttatcccttatcaagaaaaaacaactctacagcctaccttaaaattcaccaataattcaaaactctttccaaatacgtcagatccccaaaaagaaaatagaaatacaggaatagtattcggggccattttaggtgctattctgggtgtctcattgcttactcttgtgggctacttgttgtgtggaaaaaggaaaacggattcattttcccatcggcgactttatgacgacagaaatgaaccagttctgcgattagacaatgcaccggaaccttatgatgtgagttttgggaattctagctactacaatccaactttgaatgattcagccatgccagaaagtgaagaaaatgcacgtgatggcattcctatggatgacatacctccacttcgtacttctgtatag
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,762 Da
NCBI Official Full Name
Homo sapiens mucin 15, cell surface associated, mRNA
NCBI Official Synonym Full Names
mucin 15, cell surface associated
NCBI Official Symbol
MUC15
NCBI Official Synonym Symbols
PAS3; MUC-15; PASIII
NCBI Protein Information
mucin-15
UniProt Protein Name
Mucin-15
Protein Family
UniProt Gene Name
MUC15
UniProt Synonym Gene Names
MUC-15
UniProt Entry Name
MUC15_HUMAN
Uniprot Description
MUC15: May play a role in the cell adhesion to the extracellular matrix. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Cell adhesion
Chromosomal Location of Human Ortholog: 11p14.3
Cellular Component: Golgi lumen
Biological Process: O-glycan processing
Research Articles on MUC15
Similar Products
Product Notes
The MUC15 muc15 (Catalog #AAA1266637) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggcct tagccaaaat tctgttgatt tcaacgttgt tttattcact tctatcgggg agccatggaa aagaaaatca agacataaac acaacacaga acattgcaga agtttttaaa acaatggaaa ataaacctat ttctttggaa agtgaagcaa acttaaactc agataaagaa aatataacca cctcaaatct caaggcgagt cattcccctc ctttgaatct acccaacaac agccacggaa taacagattt ctccagtaac tcgtcagcag agcattcttt gggcagtcta aaacccacat ctaccatttc cacaagccct cccttgatcc atagctttgt ttctaaagtg ccttggaatg cacctatagc agatgaagat cttttgccca tctcagcaca tcccaatgct acacctgctc tgtcttcaga aaacttcact tggtctttgg tcaatgacac cgtgaaaact cctgataaca gttccattac agttagcatc ctctcttcag aaccaacttc tccatctgtg acccccttga tagtggaacc aagtggatgg cttaccacaa acagtgatag cttcactggg tttatccctt atcaagaaaa aacaactcta cagcctacct taaaattcac caataattca aaactctttc caaatacgtc agatccccaa aaagaaaata gaaatacagg aatagtattc ggggccattt taggtgctat tctgggtgtc tcattgctta ctcttgtggg ctacttgttg tgtggaaaaa ggaaaacgga ttcattttcc catcggcgac tttatgacga cagaaatgaa ccagttctgc gattagacaa tgcaccggaa ccttatgatg tgagttttgg gaattctagc tactacaatc caactttgaa tgattcagcc atgccagaaa gtgaagaaaa tgcacgtgat ggcattccta tggatgacat acctccactt cgtacttctg tatag. It is sometimes possible for the material contained within the vial of "MUC15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
