Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTX2 cdna clone

MTX2 cDNA Clone

Synonyms
MTX2; MTX2 cDNA Clone; MTX2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctctagtggcggaagccttcgtctcccagattgcagctgcagaaccttggcctgaaaatgctacattatatcagcaattgaaaggggagcaaattttactttctgacaatgcagcttctcttgcagtgcaggcctttttgcaaatgtgtaacttgcctatcaaagtagtttgtagggcaaatgcagaatatatgtctccatctggtaaagtaccttttattcatgtgggaaatcaagtagtatcagaacttggtccaatagtccaatttgttaaagccaagggccattctcttagtgatgggctggaggaagtccaaaaagcagaaatgaaagcttacatggaattagtcaacaatatgctgttgactgcagagctgtatcttcagtggtgtgatgaagctacagtaggggagatcactcatgctaggtatggatctccttacccttggcctctgaatcatattttggcctatcaaaaacagtgggaagtcaaacgtaagatgaaagctattggatggggaaagaagactctggaccaggtcttagaggatgtagaccagtgctgtcaagctctctctcaaagactgggaacacaaccgtatttcttcaataagcagcctactgaacttgacgcactggtatttggccatctatacaccattcttaccacacaattgacaaatgatgaactttctgagaaggtgaaaaactatagcaacctccttgctttctgtaggagaattgaacagcactattttgaagatcgtggtaaaggcaggctgtcatag
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,823 Da
NCBI Official Full Name
Homo sapiens metaxin 2, mRNA
NCBI Official Synonym Full Names
metaxin 2
NCBI Official Symbol
MTX2
NCBI Protein Information
metaxin-2
UniProt Protein Name
Metaxin-2
Protein Family
UniProt Gene Name
MTX2
UniProt Entry Name
MTX2_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jun 2009]

Uniprot Description

MTX2: Involved in transport of proteins into the mitochondrion. Belongs to the metaxin family.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q31.1

Cellular Component: mitochondrion

Molecular Function: protein binding

Biological Process: mitochondrial transport

Research Articles on MTX2

Similar Products

Product Notes

The MTX2 mtx2 (Catalog #AAA1270813) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctctag tggcggaagc cttcgtctcc cagattgcag ctgcagaacc ttggcctgaa aatgctacat tatatcagca attgaaaggg gagcaaattt tactttctga caatgcagct tctcttgcag tgcaggcctt tttgcaaatg tgtaacttgc ctatcaaagt agtttgtagg gcaaatgcag aatatatgtc tccatctggt aaagtacctt ttattcatgt gggaaatcaa gtagtatcag aacttggtcc aatagtccaa tttgttaaag ccaagggcca ttctcttagt gatgggctgg aggaagtcca aaaagcagaa atgaaagctt acatggaatt agtcaacaat atgctgttga ctgcagagct gtatcttcag tggtgtgatg aagctacagt aggggagatc actcatgcta ggtatggatc tccttaccct tggcctctga atcatatttt ggcctatcaa aaacagtggg aagtcaaacg taagatgaaa gctattggat ggggaaagaa gactctggac caggtcttag aggatgtaga ccagtgctgt caagctctct ctcaaagact gggaacacaa ccgtatttct tcaataagca gcctactgaa cttgacgcac tggtatttgg ccatctatac accattctta ccacacaatt gacaaatgat gaactttctg agaaggtgaa aaactatagc aacctccttg ctttctgtag gagaattgaa cagcactatt ttgaagatcg tggtaaaggc aggctgtcat ag. It is sometimes possible for the material contained within the vial of "MTX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.