MTG1 cdna clone
MTG1 cDNA Clone
Gene Names
MTG1; GTP; GTPBP7
Synonyms
MTG1; MTG1 cDNA Clone; MTG1 cdna clone
Sequence
atggccaaggggctgaagaagatgcagagcagcctgaagctggtggactgtatcatcgaggtccacgatgcccggatcccactttcaggccgcaaccctctgtttcaggaaacccttgggcttaagcctcacttgctggtcctcaacaagatggacttggcggatcttacagagcagcagaaaattatgcaacacttagaaggagaaggcctaaaaaatgtcatttttaccaactgtgtaaaggatgaaaatgtcaagcagatcatcccgatggtcactgaactgattgggagaagccaccgctaccaccgaaaagagaacctggagtactgtatcatggtcattggggtccccaacgtgggcaagtcctccctcatcaactccctccggaggcagcacctcaggaaagggaaagccaccagggtgggtggcgagcctgggatcaccagagctgtgatgtccaaaattcaggtctctgagcggcccctgatgttcctgttggacactcctggcgtgctggctcctcggattgaaagtgtggagacaggcctgaagctggccctgtgtggaacggtgctggaccacctggtcggggaggagaccatggctgactacctgctgtacaccctcaacaaacaccagcgctttgggtacgtgcagcactacggcctgggcagtgcctgtgacaacgtagagcgcgtgctgaagagtgtggctgtgaagctggggaagacgcagaaggtgaaggtgctcacgggcacgggtaacgtgaacgttattcagcctaactatcctgcggcagcccgtgacttcctgcagactttccgccgtgggctgctgggttccgtgatgctggacctcgacgtcctgcggggccaccccccggctgagactttgccctga
Sequence Length
903
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,743 Da
NCBI Official Full Name
Homo sapiens mitochondrial GTPase 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
mitochondrial ribosome associated GTPase 1
NCBI Official Symbol
MTG1
NCBI Official Synonym Symbols
GTP; GTPBP7
NCBI Protein Information
mitochondrial ribosome-associated GTPase 1
UniProt Protein Name
Mitochondrial ribosome-associated GTPase 1
Protein Family
UniProt Gene Name
MTG1
UniProt Synonym Gene Names
GTPBP7
UniProt Entry Name
MTG1_HUMAN
Uniprot Description
MTG1: Mitochondrial GTPase. May be involved in assembly of the large ribosomal subunit. Belongs to the MMR1/HSR1 GTP-binding protein family. MTG1 subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 10q26.3
Cellular Component: mitochondrial inner membrane; mitochondrial matrix; mitochondrial ribosome
Molecular Function: GTPase activity
Biological Process: ribosome biogenesis and assembly
Research Articles on MTG1
Similar Products
Product Notes
The MTG1 mtg1 (Catalog #AAA1272604) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaagg ggctgaagaa gatgcagagc agcctgaagc tggtggactg tatcatcgag gtccacgatg cccggatccc actttcaggc cgcaaccctc tgtttcagga aacccttggg cttaagcctc acttgctggt cctcaacaag atggacttgg cggatcttac agagcagcag aaaattatgc aacacttaga aggagaaggc ctaaaaaatg tcatttttac caactgtgta aaggatgaaa atgtcaagca gatcatcccg atggtcactg aactgattgg gagaagccac cgctaccacc gaaaagagaa cctggagtac tgtatcatgg tcattggggt ccccaacgtg ggcaagtcct ccctcatcaa ctccctccgg aggcagcacc tcaggaaagg gaaagccacc agggtgggtg gcgagcctgg gatcaccaga gctgtgatgt ccaaaattca ggtctctgag cggcccctga tgttcctgtt ggacactcct ggcgtgctgg ctcctcggat tgaaagtgtg gagacaggcc tgaagctggc cctgtgtgga acggtgctgg accacctggt cggggaggag accatggctg actacctgct gtacaccctc aacaaacacc agcgctttgg gtacgtgcag cactacggcc tgggcagtgc ctgtgacaac gtagagcgcg tgctgaagag tgtggctgtg aagctgggga agacgcagaa ggtgaaggtg ctcacgggca cgggtaacgt gaacgttatt cagcctaact atcctgcggc agcccgtgac ttcctgcaga ctttccgccg tgggctgctg ggttccgtga tgctggacct cgacgtcctg cggggccacc ccccggctga gactttgccc tga. It is sometimes possible for the material contained within the vial of "MTG1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
