MTFR1 cdna clone
MTFR1 cDNA Clone
Gene Names
MTFR1; CHPPR; FAM54A2
Synonyms
MTFR1; MTFR1 cDNA Clone; MTFR1 cdna clone
Sequence
atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagccatgcaacagaatggagtcccagccacccaggagaggatgcagtggcgtcttttgctgatgttggatgggtagccaaagaagaaggagagtgttcagcaagactaaggacagaggtcagatcaaggccaccccttcaggatgaccttcttttctttgagaaggccccaagcagacagatttccttaccagacttgtctcaagaagagcctcagctgaagaccccagcgcgggcaaatgaggaagcactgcagaagatttgcgctctcgaaaatgaacttgctgctctcagagctcagattgccaaaattgtgacccagcaggagcagcaaaatctcactgcaggtgacttagattctaccacatttggtaccataccaccacaccctccacctcccccaccgcccctgcctccccctgcactggggctccaccaaagtacatctgctgttgatctgattaaagaacgaagagagaaaagagccaatgctggaaagactttggttaagaacaatccaaagaaacctgaaatgccaaatatgctagagatccttaaagagatgaacagtgtaaaacttcggtcagtgaagaggtcagagcaagatgtgaagcccaagccagtggatgctactgaccctgctgccctcatagcagaggctctgaaaaagaaatttgcttatcggtatcgaagtgatagccaagatgaagttgaaaaaggaattccaaagtctgaatcagaggccacctcagagagagtgttgtttgggccacacatgttgaagccaacaggaaaaatgaaggctttaattgaaaatgtatcagactcctaa
Sequence Length
1002
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,200 Da
NCBI Official Full Name
Homo sapiens mitochondrial fission regulator 1, mRNA
NCBI Official Synonym Full Names
mitochondrial fission regulator 1
NCBI Official Symbol
MTFR1
NCBI Official Synonym Symbols
CHPPR; FAM54A2
NCBI Protein Information
mitochondrial fission regulator 1
UniProt Protein Name
Mitochondrial fission regulator 1
Protein Family
UniProt Gene Name
MTFR1
UniProt Synonym Gene Names
CHPPR; FAM54A2; KIAA0009
UniProt Entry Name
MTFR1_HUMAN
NCBI Description
This gene encodes a mitochondrial protein that is characterized by a poly-proline rich region. A chicken homolog of this protein promotes mitochondrial fission and the mouse homolog protects cells from oxidative stress. A related pseudogene of this gene is found on chromosome X. [provided by RefSeq, Mar 2009]
Uniprot Description
MTFR1: May play a role in mitochondrial aerobic respiration. May also regulate mitochondrial organization and fission. Belongs to the MTFR1/FAM54 family.
Protein type: Mitochondrial
Chromosomal Location of Human Ortholog: 8q13.1
Cellular Component: cytoplasm; mitochondrion; plasma membrane
Biological Process: aerobic respiration; mitochondrial fission; mitochondrion organization and biogenesis
Research Articles on MTFR1
Similar Products
Product Notes
The MTFR1 mtfr1 (Catalog #AAA1265695) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttggct ggattaagcg cctaattagg atggtttttc aacaagttgg agtaagcatg caatcggtac tttggtctag gaagccatat ggttcgtctc gaagtatcgt aaggaaaatt ggtactaatt tgtctctgat tcagtgtcca agagttcagt ttcagattaa cagccatgca acagaatgga gtcccagcca cccaggagag gatgcagtgg cgtcttttgc tgatgttgga tgggtagcca aagaagaagg agagtgttca gcaagactaa ggacagaggt cagatcaagg ccaccccttc aggatgacct tcttttcttt gagaaggccc caagcagaca gatttcctta ccagacttgt ctcaagaaga gcctcagctg aagaccccag cgcgggcaaa tgaggaagca ctgcagaaga tttgcgctct cgaaaatgaa cttgctgctc tcagagctca gattgccaaa attgtgaccc agcaggagca gcaaaatctc actgcaggtg acttagattc taccacattt ggtaccatac caccacaccc tccacctccc ccaccgcccc tgcctccccc tgcactgggg ctccaccaaa gtacatctgc tgttgatctg attaaagaac gaagagagaa aagagccaat gctggaaaga ctttggttaa gaacaatcca aagaaacctg aaatgccaaa tatgctagag atccttaaag agatgaacag tgtaaaactt cggtcagtga agaggtcaga gcaagatgtg aagcccaagc cagtggatgc tactgaccct gctgccctca tagcagaggc tctgaaaaag aaatttgctt atcggtatcg aagtgatagc caagatgaag ttgaaaaagg aattccaaag tctgaatcag aggccacctc agagagagtg ttgtttgggc cacacatgtt gaagccaaca ggaaaaatga aggctttaat tgaaaatgta tcagactcct aa. It is sometimes possible for the material contained within the vial of "MTFR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
