MTERFD1 cdna clone
MTERFD1 cDNA Clone
Gene Names
MTERF3; CGI-12; MTERFD1
Synonyms
MTERFD1; MTERFD1 cDNA Clone; MTERFD1 cdna clone
Sequence
atggctttgtcagcccaacagatacccagatggtttaactcagttaagttgaggagcctcattaatgctgcacaactcacaaaacgttttactagaccagcaagaacactgttacatggcttttctgctcagcctcagatatcctctgacaattgctttctccagtggggatttaagacttacaggacttcctccttatggaatagttcccagtctactagctcaagtagtcaggagaataattctgcccaaagcagtctgcttccttccatgaatgaacagtcacagaagacacaaaatatatccagctttgattctgagctgtttctagaagaactggatgaattgcctccattgtctccaatgcagccaatttcagaggaagaggctattcagattattgcagaccctccattgccaccagcttcattcacacttcgagactatgtggatcattctgagactctgcagaagttggttcttctaggcgtggatttgtccaagatagaaaaacatccagaagcagcaaacctccttctgagactggattttgaaaaagacattaagcaaatgcttctgtttcttaaagatgtgggtatagaggataaccaactgggagcattcctgacaaaaaatcatgcaattttctctgaagaccttgaaaatctgaagaccagggtggcttatctgcattcaaaaaatttcagtaaagcagatgttgcacagatggtcagaaaagcaccatttttgctgaacttttcagtggaaagactggataacagattgggattttttcagaaagaacttgaacttagtgtgaagaagactagagatctggtagttcgtctcccaaggctgctaactggaagtctggaacccgtgaaagaaaatatgaaggtttatcgtcttgaacttggttttaaacataacgaaattcaacatatgatcaccagaatcccaaagatgttaactgcaaataaaatgaaacttaccgagacgtttgattttgtgcacaatgtgatgagcattccccaccacatcattgtcaagttcccacaggtatttaatacaaggctgtttaaggtcaaagaaagacacttgtttcttacctatttaggaagagcacagtatgatccagcaaaacctaactacatctctttggacaaactagtatctattcctgatgaaatattttgtgaagagattgccaaagcatcagtacaggactttgaaaaattcttaaaaacgctttag
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,358 Da
NCBI Official Full Name
Homo sapiens MTERF domain containing 1, mRNA
NCBI Official Synonym Full Names
mitochondrial transcription termination factor 3
NCBI Official Symbol
MTERF3
NCBI Official Synonym Symbols
CGI-12; MTERFD1
NCBI Protein Information
transcription termination factor 3, mitochondrial
UniProt Protein Name
Transcription termination factor 3, mitochondrial
UniProt Gene Name
MTERF3
UniProt Synonym Gene Names
MTERFD1; mTERF3
UniProt Entry Name
MTEF3_HUMAN
Uniprot Description
MTERFD1: Binds promoter DNA and regulates initiation of transcription. Required for normal mitochondrial transcription, and for normal assembly of mitochondrial respiratory complexes. Required for normal mitochondrial function. Belongs to the mTERF family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 8q22.1
Cellular Component: mitochondrial outer membrane; mitochondrion
Molecular Function: protein binding
Biological Process: macroautophagy; negative regulation of transcription, DNA-dependent
Research Articles on MTERFD1
Similar Products
Product Notes
The MTERFD1 mterf3 (Catalog #AAA1267335) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttgt cagcccaaca gatacccaga tggtttaact cagttaagtt gaggagcctc attaatgctg cacaactcac aaaacgtttt actagaccag caagaacact gttacatggc ttttctgctc agcctcagat atcctctgac aattgctttc tccagtgggg atttaagact tacaggactt cctccttatg gaatagttcc cagtctacta gctcaagtag tcaggagaat aattctgccc aaagcagtct gcttccttcc atgaatgaac agtcacagaa gacacaaaat atatccagct ttgattctga gctgtttcta gaagaactgg atgaattgcc tccattgtct ccaatgcagc caatttcaga ggaagaggct attcagatta ttgcagaccc tccattgcca ccagcttcat tcacacttcg agactatgtg gatcattctg agactctgca gaagttggtt cttctaggcg tggatttgtc caagatagaa aaacatccag aagcagcaaa cctccttctg agactggatt ttgaaaaaga cattaagcaa atgcttctgt ttcttaaaga tgtgggtata gaggataacc aactgggagc attcctgaca aaaaatcatg caattttctc tgaagacctt gaaaatctga agaccagggt ggcttatctg cattcaaaaa atttcagtaa agcagatgtt gcacagatgg tcagaaaagc accatttttg ctgaactttt cagtggaaag actggataac agattgggat tttttcagaa agaacttgaa cttagtgtga agaagactag agatctggta gttcgtctcc caaggctgct aactggaagt ctggaacccg tgaaagaaaa tatgaaggtt tatcgtcttg aacttggttt taaacataac gaaattcaac atatgatcac cagaatccca aagatgttaa ctgcaaataa aatgaaactt accgagacgt ttgattttgt gcacaatgtg atgagcattc cccaccacat cattgtcaag ttcccacagg tatttaatac aaggctgttt aaggtcaaag aaagacactt gtttcttacc tatttaggaa gagcacagta tgatccagca aaacctaact acatctcttt ggacaaacta gtatctattc ctgatgaaat attttgtgaa gagattgcca aagcatcagt acaggacttt gaaaaattct taaaaacgct ttag. It is sometimes possible for the material contained within the vial of "MTERFD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
