Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSRB2 cdna clone

MSRB2 cDNA Clone

Gene Names
MSRB2; CBS1; MSRB; PILB; CBS-1; CGI-131
Synonyms
MSRB2; MSRB2 cDNA Clone; MSRB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcggctcctctggttgctccggggcctgaccctcggaactgcgcctcggcgggcggtgcggggccaagcgggcggcggcgggcccggcaccgggccgggactgggggaggcagggtctcttgcaacgtgtgagctgcctcttgccaagagtgagtggcaaaagaaactaaccccggagcagttctacgtcacaagagaaaagggaacggaaccgcctttcagtgggatctacctgaataacaaggaagcaggaatgtatcattgcgtgtgctgcgacagtccactcttcagttctgagaaaaagtactgctctggcactgggtggccttcgttttccgaggctcatggtacgtctggctctgatgaaagccacacagggatcctgagacgtctggatacctcgttaggatcagctcgcacagaggttgtctgcaagcagtgtgaagctcatctaggtcacgtgtttcctgatggacctgggcccaatggtcagaggttttgcatcaacagtgtggctttgaagttcaaaccaaggaaacactga
Sequence Length
549
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,536 Da
NCBI Official Full Name
Homo sapiens methionine sulfoxide reductase B2, mRNA
NCBI Official Synonym Full Names
methionine sulfoxide reductase B2
NCBI Official Symbol
MSRB2
NCBI Official Synonym Symbols
CBS1; MSRB; PILB; CBS-1; CGI-131
NCBI Protein Information
methionine-R-sulfoxide reductase B2, mitochondrial
UniProt Protein Name
Methionine-R-sulfoxide reductase B2, mitochondrial
UniProt Gene Name
MSRB2
UniProt Synonym Gene Names
CBS-1; MSRB; MsrB2
UniProt Entry Name
MSRB2_HUMAN

Uniprot Description

MSRB2: Catalyzes the reduction of free and protein-bound methionine sulfoxide to methionine. Upon oxidative stress, may play a role in the preservation of mitochondrial integrity by decreasing the intracellular reactive oxygen species build-up through its scavenging role, hence contributing to cell survival and protein maintenance. Belongs to the MsrB Met sulfoxide reductase family.

Protein type: Oxidoreductase; Transcription factor; Mitochondrial; EC 1.8.4.-

Chromosomal Location of Human Ortholog: 10p12

Cellular Component: cytosol; mitochondrion

Molecular Function: actin binding; peptide-methionine (R)-S-oxide reductase activity; transcription factor activity; zinc ion binding

Biological Process: actin filament polymerization; protein repair

Research Articles on MSRB2

Similar Products

Product Notes

The MSRB2 msrb2 (Catalog #AAA1270573) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcggc tcctctggtt gctccggggc ctgaccctcg gaactgcgcc tcggcgggcg gtgcggggcc aagcgggcgg cggcgggccc ggcaccgggc cgggactggg ggaggcaggg tctcttgcaa cgtgtgagct gcctcttgcc aagagtgagt ggcaaaagaa actaaccccg gagcagttct acgtcacaag agaaaaggga acggaaccgc ctttcagtgg gatctacctg aataacaagg aagcaggaat gtatcattgc gtgtgctgcg acagtccact cttcagttct gagaaaaagt actgctctgg cactgggtgg ccttcgtttt ccgaggctca tggtacgtct ggctctgatg aaagccacac agggatcctg agacgtctgg atacctcgtt aggatcagct cgcacagagg ttgtctgcaa gcagtgtgaa gctcatctag gtcacgtgtt tcctgatgga cctgggccca atggtcagag gttttgcatc aacagtgtgg ctttgaagtt caaaccaagg aaacactga. It is sometimes possible for the material contained within the vial of "MSRB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.