Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSH3 cdna clone

MSH3 cDNA Clone

Gene Names
MSH3; DUP; MRP1
Synonyms
MSH3; MSH3 cDNA Clone; MSH3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgccggaagcctgcgtcgggcggcctcgctgcctccagctcagcccctgcgaggcaagcggttttgagccgattcttccagtctacgggaagcctgaaatccacctcctcctccacaggtgcagccgaccaggtggaccctggcgctgcagcggctgcagcggccgcagcggccacagcgcccccagcgcccccagctcccgccttcccgccccagctgccgccgcacatagctacagaaattgacagaagaaagaagagaccattggaaaatgatgggcctgttaaaaagaaagtaaagaaagtccaacaaaaggaaggaggaagtgatctgggaatgtctggcaactctgagccaaagaaatgtctgaggaccaggaatgtttcaaagtctctggaaaaattgaaagaattctgctgcgattctgcccttcctcaaagtagagtccagacagaatctctgcaggagagatttgcagttctgccaaaatgtactgattttgatgatatcagtcttctacacgcaaagaatgcagtttcttctgaagattcgaaacgtcaaattaatcaaaaggacacaacactttttgatctcagtcagtttggatcatcaaatacaagtcatgaaaatttacagaaaactgcttccaaatcagctaacaaacggtccaaaagcatctatacgccgctagaattacaatacatagaaatgaagcagcagcacaaagatgcagttttgtgtgtggaatgtggatataagtatagattctttggggaagatgcagagattgcagcccgagagctcaatatttattgccatttagatcacaactttatgacagcaagtatacctactcacagactgtttgttcatgtacgccgcctggtggcaaaaggatataaggtgggagttgtgaagcaaactgaaactgcagcattaaaggccattggagacaacagaagttcactcttttcccggaaattgactgccctttatacaaaatctacacttattggagaagatgtgaatcccctaatcaagctggatgatgctgtaaatgttgatgagataatgactgatacttctaccagctatcttctgtgcatctctgaaaataaggaaaatgttagggacaaaaaaaagggcaacatttttattggcattgtgggagtgcagcctgccacaggcgaggttgtgtttgatagtttccaggactctgcttctcgttcagagctagaaacccggatgtcaagcctgcagccagtagagctgctgcttccttcggccttgtccgagcaaacagaggcgctcatccacagagccacatctgttagtgtgcaggatgacagaattcgagtcgaaaggatggataacatttattttgaatacagccatgctttccaggcagttacagagttttatgcaaaagatacagttgacatcaaaggttctcaaattatttctggcattgttaacttagagaagcctgtgatttgctctttggctgccatcataaaatacctcaaagaattcaacttggaaaagatgctctccaaacctgagaattttaaacagctatcaagtaaaatggaatttatgacaattaatggaacaacattaaggaatctggaaatcctacagaatcagactgatatgaaaaccaaaggaagtttgctgtgggttttagaccacactaaaacttcatttgggagacggaagttaaagaagtgggtgacccagccactccttaaattaagggaaataaatgcccggcttgatgctgtatcggaagttctccattcagaatctagtgtgtttggtcagatagaaaatcatctacgtaaattgcccgacatagagaggggactctgtagcatttatcacaaaaaatgttctacccaagagttcttcttgattgtcaaaactttatatcacctaaagtcagaatttcaagcaataatacctgctgttaattcccacattcagtcagacttgctccggaccgttattttagaaattcctgaactcctcagtccagtggagcattacttaaagatactcaatgaacaagctgccaaagttggggataaaactgaattatttaaagacctttctgacttccctttaataaaaaagaggaaggatgaaattcaaggtgttattgacgagatccgaatgcatttgcaagaaatacgaaaaatactaaaaaatccttctgcacaatatgtgacagtatcaggacaggagtttatgatagaaataaagaactctgctgtatcttgtataccaactgattgggtaaaggttggaagcacaaaagctgtgagccgctttcactctccttttattgtagaaaattacagacatctgaatcagctccgggagcagctagtccttgactgcagtgctgaatggcttgattttctagagaaattcagtgaacattatcactccttgtgtaaagcagtgcatcacctagcaactgttgactgcattttctccctggccaaggtcgctaagcaaggagattactgcagaccaactgtacaagaagaaagaaaaattgtaataaaaaatggaaggcaccctgtgattgatgtgttgctgggagaacaggatcaatatgtcccaaataatacagatttatcagaggactcagagagagtaatgataattaccggaccaaacatgggtggaaagagctcctacataaaacaagttgcattgattaccatcatggctcagattggctcctatgttcctgcagaagaagcgacaattgggattgtggatggcattttcacaaggatgggtgctgcagacaatatatataaaggacggagtacatttatggaagaactgactgacacagcagaaataatcagaaaagcaacatcacagtccttggttatcttggatgaactaggaagagggacgagcactcatgatggaattgccattgcctatgctacacttgagtatttcatcagagatgtgaaatccttaaccctgtttgtcacccattatccgccagtttgtgaactagaaaaaaattactcacaccaggtggggaattaccacatgggattcttggtcagtgaggatgaaagcaaactggatccaggcacagcagaacaagtccctgattttgtcaccttcctttaccaaataactagaggaattgcagcaaggagttatggattaaatgtggctaaactagcagatgttcctggagaaattttgaagaaagcagctcacaagtcaaaagagctggaaggattaataaatacgaaaagaaagagactcaagtattttgcaaagttatggacgatgcataatgcacaagacctgcagaagtggacagaggagttcaacatggaagaaacacagacttctcttcttcattaa
Sequence Length
3414
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
127,412 Da
NCBI Official Full Name
Homo sapiens mutS homolog 3 (E. coli), mRNA
NCBI Official Synonym Full Names
mutS homolog 3
NCBI Official Symbol
MSH3
NCBI Official Synonym Symbols
DUP; MRP1
NCBI Protein Information
DNA mismatch repair protein Msh3
UniProt Protein Name
DNA mismatch repair protein Msh3
UniProt Gene Name
MSH3
UniProt Synonym Gene Names
DUC1; DUG; hMSH3; DUP; MRP1
UniProt Entry Name
MSH3_HUMAN

NCBI Description

The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]

Uniprot Description

MSH3: Component of the post-replicative DNA mismatch repair system (MMR). Heterodimerizes with MSH2 to form MutS beta which binds to DNA mismatches thereby initiating DNA repair. When bound, the MutS beta heterodimer bends the DNA helix and shields approximately 20 base pairs. MutS beta recognizes large insertion- deletion loops (IDL) up to 13 nucleotides long. After mismatch binding, forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. Defects in MSH3 are a cause of susceptibility to endometrial cancer (ENDMC). Belongs to the DNA mismatch repair MutS family. MSH3 subfamily.

Protein type: DNA repair, damage

Chromosomal Location of Human Ortholog: 5q11-q12

Cellular Component: membrane; MutSbeta complex; nuclear chromosome; nucleoplasm

Molecular Function: damaged DNA binding; dinucleotide insertion or deletion binding; dinucleotide repeat insertion binding; enzyme binding; guanine/thymine mispair binding; mismatched DNA binding; oxidized purine DNA binding; protein binding; protein homodimerization activity; single guanine insertion binding; single-stranded DNA binding

Biological Process: DNA repair; maintenance of DNA repeat elements; meiotic mismatch repair; meiotic recombination; mismatch repair; negative regulation of DNA recombination; positive regulation of helicase activity

Disease: Endometrial Cancer

Research Articles on MSH3

Similar Products

Product Notes

The MSH3 msh3 (Catalog #AAA1268517) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcgcc ggaagcctgc gtcgggcggc ctcgctgcct ccagctcagc ccctgcgagg caagcggttt tgagccgatt cttccagtct acgggaagcc tgaaatccac ctcctcctcc acaggtgcag ccgaccaggt ggaccctggc gctgcagcgg ctgcagcggc cgcagcggcc acagcgcccc cagcgccccc agctcccgcc ttcccgcccc agctgccgcc gcacatagct acagaaattg acagaagaaa gaagagacca ttggaaaatg atgggcctgt taaaaagaaa gtaaagaaag tccaacaaaa ggaaggagga agtgatctgg gaatgtctgg caactctgag ccaaagaaat gtctgaggac caggaatgtt tcaaagtctc tggaaaaatt gaaagaattc tgctgcgatt ctgcccttcc tcaaagtaga gtccagacag aatctctgca ggagagattt gcagttctgc caaaatgtac tgattttgat gatatcagtc ttctacacgc aaagaatgca gtttcttctg aagattcgaa acgtcaaatt aatcaaaagg acacaacact ttttgatctc agtcagtttg gatcatcaaa tacaagtcat gaaaatttac agaaaactgc ttccaaatca gctaacaaac ggtccaaaag catctatacg ccgctagaat tacaatacat agaaatgaag cagcagcaca aagatgcagt tttgtgtgtg gaatgtggat ataagtatag attctttggg gaagatgcag agattgcagc ccgagagctc aatatttatt gccatttaga tcacaacttt atgacagcaa gtatacctac tcacagactg tttgttcatg tacgccgcct ggtggcaaaa ggatataagg tgggagttgt gaagcaaact gaaactgcag cattaaaggc cattggagac aacagaagtt cactcttttc ccggaaattg actgcccttt atacaaaatc tacacttatt ggagaagatg tgaatcccct aatcaagctg gatgatgctg taaatgttga tgagataatg actgatactt ctaccagcta tcttctgtgc atctctgaaa ataaggaaaa tgttagggac aaaaaaaagg gcaacatttt tattggcatt gtgggagtgc agcctgccac aggcgaggtt gtgtttgata gtttccagga ctctgcttct cgttcagagc tagaaacccg gatgtcaagc ctgcagccag tagagctgct gcttccttcg gccttgtccg agcaaacaga ggcgctcatc cacagagcca catctgttag tgtgcaggat gacagaattc gagtcgaaag gatggataac atttattttg aatacagcca tgctttccag gcagttacag agttttatgc aaaagataca gttgacatca aaggttctca aattatttct ggcattgtta acttagagaa gcctgtgatt tgctctttgg ctgccatcat aaaatacctc aaagaattca acttggaaaa gatgctctcc aaacctgaga attttaaaca gctatcaagt aaaatggaat ttatgacaat taatggaaca acattaagga atctggaaat cctacagaat cagactgata tgaaaaccaa aggaagtttg ctgtgggttt tagaccacac taaaacttca tttgggagac ggaagttaaa gaagtgggtg acccagccac tccttaaatt aagggaaata aatgcccggc ttgatgctgt atcggaagtt ctccattcag aatctagtgt gtttggtcag atagaaaatc atctacgtaa attgcccgac atagagaggg gactctgtag catttatcac aaaaaatgtt ctacccaaga gttcttcttg attgtcaaaa ctttatatca cctaaagtca gaatttcaag caataatacc tgctgttaat tcccacattc agtcagactt gctccggacc gttattttag aaattcctga actcctcagt ccagtggagc attacttaaa gatactcaat gaacaagctg ccaaagttgg ggataaaact gaattattta aagacctttc tgacttccct ttaataaaaa agaggaagga tgaaattcaa ggtgttattg acgagatccg aatgcatttg caagaaatac gaaaaatact aaaaaatcct tctgcacaat atgtgacagt atcaggacag gagtttatga tagaaataaa gaactctgct gtatcttgta taccaactga ttgggtaaag gttggaagca caaaagctgt gagccgcttt cactctcctt ttattgtaga aaattacaga catctgaatc agctccggga gcagctagtc cttgactgca gtgctgaatg gcttgatttt ctagagaaat tcagtgaaca ttatcactcc ttgtgtaaag cagtgcatca cctagcaact gttgactgca ttttctccct ggccaaggtc gctaagcaag gagattactg cagaccaact gtacaagaag aaagaaaaat tgtaataaaa aatggaaggc accctgtgat tgatgtgttg ctgggagaac aggatcaata tgtcccaaat aatacagatt tatcagagga ctcagagaga gtaatgataa ttaccggacc aaacatgggt ggaaagagct cctacataaa acaagttgca ttgattacca tcatggctca gattggctcc tatgttcctg cagaagaagc gacaattggg attgtggatg gcattttcac aaggatgggt gctgcagaca atatatataa aggacggagt acatttatgg aagaactgac tgacacagca gaaataatca gaaaagcaac atcacagtcc ttggttatct tggatgaact aggaagaggg acgagcactc atgatggaat tgccattgcc tatgctacac ttgagtattt catcagagat gtgaaatcct taaccctgtt tgtcacccat tatccgccag tttgtgaact agaaaaaaat tactcacacc aggtggggaa ttaccacatg ggattcttgg tcagtgagga tgaaagcaaa ctggatccag gcacagcaga acaagtccct gattttgtca ccttccttta ccaaataact agaggaattg cagcaaggag ttatggatta aatgtggcta aactagcaga tgttcctgga gaaattttga agaaagcagc tcacaagtca aaagagctgg aaggattaat aaatacgaaa agaaagagac tcaagtattt tgcaaagtta tggacgatgc ataatgcaca agacctgcag aagtggacag aggagttcaa catggaagaa acacagactt ctcttcttca ttaa. It is sometimes possible for the material contained within the vial of "MSH3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.