Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRTO4 cdna clone

MRTO4 cDNA Clone

Gene Names
MRTO4; MRT4; C1orf33; dJ657E11.4
Synonyms
MRTO4; MRTO4 cDNA Clone; MRTO4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaaatccaagcgcgacaagaaagtctccttaaccaaaactgccaagaaaggcttggaattgaaacaaaacctgatagaagagcttcggaaatgtgtggacacctacaagtaccttttcatcttctctgtggccaacatgaggaacagcaagctgaaggacatccggaacgcctggaagcacagccggatgttctttggcaaaaacaaggtgatgatggtggccttgggtcggagcccatctgatgaatacaaagacaacctgcaccaggtcagcaaaaggttgaggggtgaggtgggtctcctgttcaccaaccgcacaaaggaagaggtgaatgagtggttcacgaaatacacagaaatggactacgcccgagctggtaacaaagcagctttcactgtgagcctggatccagggcccctggagcagttcccccactccatggagccacagctcaggcagctgggcctgcccaccgccctcaagagaggtgtggtgactctgctgtctgactacgaggtgtgcaaggagggcgatgtgctgaccccagagcaggctcgcgtcctgaagctttttgggtatgagatggctgaattcaaggtgaccatcaaatacatgtgggattcacagtcgggaaggttccagcagatgggagacgacttgccagagagcgcatctgagtccacagaagagtcagactcagaagatgatgactga
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,560 Da
NCBI Official Full Name
Homo sapiens mRNA turnover 4 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
MRT4 homolog, ribosome maturation factor
NCBI Official Symbol
MRTO4
NCBI Official Synonym Symbols
MRT4; C1orf33; dJ657E11.4
NCBI Protein Information
mRNA turnover protein 4 homolog
UniProt Protein Name
mRNA turnover protein 4 homolog
Protein Family
UniProt Gene Name
MRTO4
UniProt Synonym Gene Names
C1orf33; MRT4
UniProt Entry Name
MRT4_HUMAN

NCBI Description

This gene encodes a protein sharing a low level of sequence similarity with ribosomal protein P0. While the precise function of the encoded protein is currently unknown, it appears to be involved in mRNA turnover and ribosome assembly. [provided by RefSeq, Jul 2008]

Uniprot Description

MRTO4: Involved in mRNA turnover and ribosome assembly. Belongs to the ribosomal protein L10P family.

Protein type: Nucleolus; RNA-binding

Chromosomal Location of Human Ortholog: 1p36.13

Cellular Component: nuclear membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; structural constituent of ribosome

Biological Process: ribosomal large subunit assembly and maintenance; rRNA processing

Research Articles on MRTO4

Similar Products

Product Notes

The MRTO4 mrto4 (Catalog #AAA1276390) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaaat ccaagcgcga caagaaagtc tccttaacca aaactgccaa gaaaggcttg gaattgaaac aaaacctgat agaagagctt cggaaatgtg tggacaccta caagtacctt ttcatcttct ctgtggccaa catgaggaac agcaagctga aggacatccg gaacgcctgg aagcacagcc ggatgttctt tggcaaaaac aaggtgatga tggtggcctt gggtcggagc ccatctgatg aatacaaaga caacctgcac caggtcagca aaaggttgag gggtgaggtg ggtctcctgt tcaccaaccg cacaaaggaa gaggtgaatg agtggttcac gaaatacaca gaaatggact acgcccgagc tggtaacaaa gcagctttca ctgtgagcct ggatccaggg cccctggagc agttccccca ctccatggag ccacagctca ggcagctggg cctgcccacc gccctcaaga gaggtgtggt gactctgctg tctgactacg aggtgtgcaa ggagggcgat gtgctgaccc cagagcaggc tcgcgtcctg aagctttttg ggtatgagat ggctgaattc aaggtgacca tcaaatacat gtgggattca cagtcgggaa ggttccagca gatgggagac gacttgccag agagcgcatc tgagtccaca gaagagtcag actcagaaga tgatgactga. It is sometimes possible for the material contained within the vial of "MRTO4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.