Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MR1 cdna clone

MR1 cDNA Clone

Gene Names
MR1; HLALS
Synonyms
MR1; MR1 cDNA Clone; MR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggaactgatggcgttcctgttacctctcatcattgtgttaatggtgaagcacagcgattcccggacgcactctctgagatattttcgcctgggcgtttcggatcccatccatggggtccctgaatttatttcggttgggtacgtggactcgcaccctatcaccacatatgacagtgtcactcggcagaaggagccacgggccccatggatggcagagaacctcgcgcctgatcactgggagaggtacactcagctgctgaggggctggcagcagatgttcaaggtggaactgaagcgcctacagaggcactacaatcactcagataatgtggctcacaccatcaagcaggcatgggaggccaatcagcatgagttgctgtatcaaaagaattggctggaagaagaatgtattgcctggctaaagagattcctggagtatgggaaagacaccctacaaagaacagagcccccactggtcagagtaaatcgcaaagaaacttttccaggggttacagctctcttctgcaaagctcatggcttttaccccccagaaatttacatgacatggatgaaaaacggggaagaaattgtccaagaaattgattatggagacattcttcccagtggggatggaacctatcaggcgtgggcatcaattgagcttgatcctcagagcagcaacctttactcctgtcatgtggagcactgcggtgtccacatggttcttcaggtcccccaggaatcagaaactatccctcttgtgatgaaagctgtctctgggtccattgtccttgtcattgtgctggctggagttggtgttctagtctggagaagaaggccccgagagcaaaatggagccatctaccttccaacaccagatcgatga
Sequence Length
891
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,190 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class I-related, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class I-related
NCBI Official Symbol
MR1
NCBI Official Synonym Symbols
HLALS
NCBI Protein Information
major histocompatibility complex class I-related gene protein
UniProt Protein Name
Major histocompatibility complex class I-related gene protein
UniProt Gene Name
MR1
UniProt Synonym Gene Names
MHC class I-related gene protein
UniProt Entry Name
HMR1_HUMAN

NCBI Description

MAIT (mucosal-associated invariant T-cells) lymphocytes represent a small population of T-cells primarily found in the gut. The protein encoded by this gene is an antigen-presenting molecule that presents metabolites of microbial vitamin B to MAITs. This presentation may activate the MAITs to regulate the amounts of specific types of bacteria in the gut. Several transcript variants encoding different isoforms have been found for this gene, and a pseudogene of it has been detected about 36 kbp upstream on the same chromosome. [provided by RefSeq, Jul 2015]

Uniprot Description

MR1: Has antigen presentation function. Involved in the development and expansion of a small population of T-cells expressing an invariant T-cell receptor alpha chain called mucosal-associated invariant T-cells (MAIT). MAIT cells are preferentially located in the gut lamina propria and therefore may be involved in monitoring commensal flora or serve as a distress signal. Expression and MAIT cell recognition seem to be ligand- dependent. Belongs to the MHC class I family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q25.3

Cellular Component: endoplasmic reticulum; plasma membrane

Molecular Function: antigen binding; MHC class I receptor activity; protein binding

Biological Process: antigen processing and presentation; immune response

Research Articles on MR1

Similar Products

Product Notes

The MR1 mr1 (Catalog #AAA1273789) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaac tgatggcgtt cctgttacct ctcatcattg tgttaatggt gaagcacagc gattcccgga cgcactctct gagatatttt cgcctgggcg tttcggatcc catccatggg gtccctgaat ttatttcggt tgggtacgtg gactcgcacc ctatcaccac atatgacagt gtcactcggc agaaggagcc acgggcccca tggatggcag agaacctcgc gcctgatcac tgggagaggt acactcagct gctgaggggc tggcagcaga tgttcaaggt ggaactgaag cgcctacaga ggcactacaa tcactcagat aatgtggctc acaccatcaa gcaggcatgg gaggccaatc agcatgagtt gctgtatcaa aagaattggc tggaagaaga atgtattgcc tggctaaaga gattcctgga gtatgggaaa gacaccctac aaagaacaga gcccccactg gtcagagtaa atcgcaaaga aacttttcca ggggttacag ctctcttctg caaagctcat ggcttttacc ccccagaaat ttacatgaca tggatgaaaa acggggaaga aattgtccaa gaaattgatt atggagacat tcttcccagt ggggatggaa cctatcaggc gtgggcatca attgagcttg atcctcagag cagcaacctt tactcctgtc atgtggagca ctgcggtgtc cacatggttc ttcaggtccc ccaggaatca gaaactatcc ctcttgtgat gaaagctgtc tctgggtcca ttgtccttgt cattgtgctg gctggagttg gtgttctagt ctggagaaga aggccccgag agcaaaatgg agccatctac cttccaacac cagatcgatg a. It is sometimes possible for the material contained within the vial of "MR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.