Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MPST cdna clone

MPST cDNA Clone

Gene Names
MPST; MST; TST2; TUM1
Synonyms
MPST; MPST cDNA Clone; MPST cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcgccgcagctctgccgcgcgctggtgtcggcgcaatgggtggcggaggcgctgcgggccccgcgcgctgggcagcctctgcagctgctggacgcctcctggtacctgccgaagctggggcgcgacgcgcgacgcgagttcgaggagcgccacatcccgggcgccgctttcttcgacatcgaccagtgcagcgaccgcacctcgccctacgaccacatgctgcccggggccgagcatttcgcggagtacgcaggccgcctgggcgtgggcgcggccacccacgtcgtgatctacgacgccagcgaccagggcctctactccgccccgcgcgtctggtggatgttccgcgccttcggccaccacgccgtgtcactgcttgatggcggcctccgccactggctgcgccagaacctcccgctcagctccggcaagagccaacctgctcccgccgagttccgcgcttag
Sequence Length
471
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,250 Da
NCBI Official Full Name
Homo sapiens mercaptopyruvate sulfurtransferase, mRNA
NCBI Official Synonym Full Names
mercaptopyruvate sulfurtransferase
NCBI Official Symbol
MPST
NCBI Official Synonym Symbols
MST; TST2; TUM1
NCBI Protein Information
3-mercaptopyruvate sulfurtransferase
UniProt Protein Name
3-mercaptopyruvate sulfurtransferase
UniProt Gene Name
MPST
UniProt Synonym Gene Names
TST2; MST
UniProt Entry Name
THTM_HUMAN

NCBI Description

This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MPST: Transfer of a sulfur ion to cyanide or to other thiol compounds. Also has weak rhodanese activity. May have a role in cyanide degradation or in thiosulfate biosynthesis.

Protein type: Mitochondrial; Amino Acid Metabolism - cysteine and methionine; EC 2.8.1.2; Transferase

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: neuron projection

Biological Process: cyanate catabolic process; response to toxin

Research Articles on MPST

Similar Products

Product Notes

The MPST mpst (Catalog #AAA1267321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcgc cgcagctctg ccgcgcgctg gtgtcggcgc aatgggtggc ggaggcgctg cgggccccgc gcgctgggca gcctctgcag ctgctggacg cctcctggta cctgccgaag ctggggcgcg acgcgcgacg cgagttcgag gagcgccaca tcccgggcgc cgctttcttc gacatcgacc agtgcagcga ccgcacctcg ccctacgacc acatgctgcc cggggccgag catttcgcgg agtacgcagg ccgcctgggc gtgggcgcgg ccacccacgt cgtgatctac gacgccagcg accagggcct ctactccgcc ccgcgcgtct ggtggatgtt ccgcgccttc ggccaccacg ccgtgtcact gcttgatggc ggcctccgcc actggctgcg ccagaacctc ccgctcagct ccggcaagag ccaacctgct cccgccgagt tccgcgctta g. It is sometimes possible for the material contained within the vial of "MPST, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.