Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MOCS3 cdna clone

MOCS3 cDNA Clone

Gene Names
MOCS3; UBA4
Synonyms
MOCS3; MOCS3 cDNA Clone; MOCS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcccgggaggaggtactcgccttacaagctgaagttgcccaacgtgaggaggaattgaattcgctgaagcagaagctggcgtcggctcttttggctgagcaggaaccgcagccagaacggctggttccggtgtcgccgctgccgccgaaggccgctctgtcccgagatgagattctgcgctatagccggcagctagtgctgcccgagctgggcgtgcacggacagctgcgcctggggaccgcgtgcgtgctaatcgtgggctgcggtggactcggctgtccactagcgcagtacttggcagcggccggcgtgggccgccttggccttgtggactatgacgtggtagagatgagcaacctggcccgccaagtgctgcatggcgaggcactggctggccaggccaaggccttttcggccgccgcctcgctgcgccgcctcaattcggcagtggaatgcgtgccgtacactcaggcccttacgccagccactgccctagacctggtccgccgatatgatgtggtggctgactgctcggacaacgtgcccactcgctacctggttaatgacgcatgtgtgctggcgggtcggcccctcgtgtctgccagtgccttgcgcttcgagggccaaatcacagtctaccattatgacggtggcccttgctatcgctgcatattcccccaaccacccccagcggagacagtgaccaactgcgcggacggcggggtgctcggtgtcgttaccggggtcctgggctgcctgcaggccttggaagtgctgaaaatcgctgcgggtctgggcccctcttacagtggcagcttgttgctctttgatgccctgagagggcatttccgctctattcggctgcggagccgcaggctcgactgtgcagcttgcggggaacggcccactgtgactgatctgctggactatgaagccttctgtggctcctcagccactgataaatgccgctccctgcaactactgagcccagaggagcgtgtttctgtcaccgactataagcgactgctggattctggggcattccacctgttgctggacgtcaggcctcaggtggaggtggacatttgtcgtttgcctcatgccctacacatccctctgaaacatttggaacgcagggatgcggagagcctgaaactcttaaaagaagcaatctgggaagagaagcagggcacacaagaaggggctgctgtccccatttatgtgatttgcaaactgggaaatgactcacagaaagccgtgaagatcctccagtccttatcagcagctcaagagttagaccctttaacagttcgggatgttgtggggggcctcatggcctgggctgccaaaatcgatggaacatttccacagtactga
Sequence Length
1383
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,669 Da
NCBI Official Full Name
Homo sapiens molybdenum cofactor synthesis 3, mRNA
NCBI Official Synonym Full Names
molybdenum cofactor synthesis 3
NCBI Official Symbol
MOCS3
NCBI Official Synonym Symbols
UBA4
NCBI Protein Information
adenylyltransferase and sulfurtransferase MOCS3
UniProt Protein Name
Adenylyltransferase and sulfurtransferase MOCS3
UniProt Gene Name
MOCS3
UniProt Synonym Gene Names
MPT synthase sulfurylase
UniProt Entry Name
MOCS3_HUMAN

NCBI Description

Molybdenum cofactor (MoCo) is necessary for the function of all molybdoenzymes. The protein encoded by this gene adenylates and activates molybdopterin synthase, an enzyme required for biosynthesis of MoCo. This gene contains no introns. A pseudogene of this gene is present on chromosome 14. [provided by RefSeq, Nov 2012]

Uniprot Description

MOCS3: Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Also essential during biosynthesis of the molybdenum cofactor. Acts by mediating the C-terminal thiocarboxylation of sulfur carriers URM1 and MOCS2A. Its N-terminus first activates URM1 and MOCS2A as acyl-adenylates (-COAMP), then the persulfide sulfur on the catalytic cysteine is transferred to URM1 and MOCS2A to form thiocarboxylation (-COSH) of their C-terminus. The reaction probably involves hydrogen sulfide that is generated from the persulfide intermediate and that acts as nucleophile towards URM1 and MOCS2A. Subsequently, a transient disulfide bond is formed. Does not use thiosulfate as sulfur donor; NFS1 probably acting as a sulfur donor for thiocarboxylation reactions.

Protein type: EC 2.8.1.11; EC 2.7.7.80; Ligase; Transferase

Chromosomal Location of Human Ortholog: 20q13.13

Cellular Component: cytosol

Molecular Function: nucleotidyltransferase activity; protein binding; sulfurtransferase activity; thiosulfate sulfurtransferase activity; URM1 activating enzyme activity

Biological Process: enzyme active site formation via L-cysteine persulfide; Mo-molybdopterin cofactor biosynthetic process; molybdopterin cofactor biosynthetic process; protein urmylation; tRNA wobble uridine modification

Research Articles on MOCS3

Similar Products

Product Notes

The MOCS3 mocs3 (Catalog #AAA1278725) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttccc gggaggaggt actcgcctta caagctgaag ttgcccaacg tgaggaggaa ttgaattcgc tgaagcagaa gctggcgtcg gctcttttgg ctgagcagga accgcagcca gaacggctgg ttccggtgtc gccgctgccg ccgaaggccg ctctgtcccg agatgagatt ctgcgctata gccggcagct agtgctgccc gagctgggcg tgcacggaca gctgcgcctg gggaccgcgt gcgtgctaat cgtgggctgc ggtggactcg gctgtccact agcgcagtac ttggcagcgg ccggcgtggg ccgccttggc cttgtggact atgacgtggt agagatgagc aacctggccc gccaagtgct gcatggcgag gcactggctg gccaggccaa ggccttttcg gccgccgcct cgctgcgccg cctcaattcg gcagtggaat gcgtgccgta cactcaggcc cttacgccag ccactgccct agacctggtc cgccgatatg atgtggtggc tgactgctcg gacaacgtgc ccactcgcta cctggttaat gacgcatgtg tgctggcggg tcggcccctc gtgtctgcca gtgccttgcg cttcgagggc caaatcacag tctaccatta tgacggtggc ccttgctatc gctgcatatt cccccaacca cccccagcgg agacagtgac caactgcgcg gacggcgggg tgctcggtgt cgttaccggg gtcctgggct gcctgcaggc cttggaagtg ctgaaaatcg ctgcgggtct gggcccctct tacagtggca gcttgttgct ctttgatgcc ctgagagggc atttccgctc tattcggctg cggagccgca ggctcgactg tgcagcttgc ggggaacggc ccactgtgac tgatctgctg gactatgaag ccttctgtgg ctcctcagcc actgataaat gccgctccct gcaactactg agcccagagg agcgtgtttc tgtcaccgac tataagcgac tgctggattc tggggcattc cacctgttgc tggacgtcag gcctcaggtg gaggtggaca tttgtcgttt gcctcatgcc ctacacatcc ctctgaaaca tttggaacgc agggatgcgg agagcctgaa actcttaaaa gaagcaatct gggaagagaa gcagggcaca caagaagggg ctgctgtccc catttatgtg atttgcaaac tgggaaatga ctcacagaaa gccgtgaaga tcctccagtc cttatcagca gctcaagagt tagacccttt aacagttcgg gatgttgtgg ggggcctcat ggcctgggct gccaaaatcg atggaacatt tccacagtac tga. It is sometimes possible for the material contained within the vial of "MOCS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.