Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MOCS2 cdna clone

MOCS2 cDNA Clone

Gene Names
MOCS2; MPTS; MCBPE; MOCO1; MOCODB
Synonyms
MOCS2; MOCS2 cDNA Clone; MOCS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgagcttggagatcagctcctcgtgcttcagcctggagacgaaattgccgttatcccccccattagtggaggatagtgcttttgagccatctaggaaagatatggatgaagttgaagagaaatctaaagatgttataaactttactgccgagaaactttcagtagatgaagtctcacagttggtgatttctccgctctgtggtgcaatatccctatttgtagggactacaagaaataactttgaagggaaaaaagtcattagcttagaatatgaagcatatctacccatggcggaaaatgaagtcagaaagatttgtagtgacattaggcagaaatggccagtcaaacacatagcagtgttccatagacttggcttggttccagtgtcagaagcaagcataatcattgctgtgtcctcagcccacagagctgcatctcttgaagctgtgagctatgccattgatactttaaaagccaaggtgcccatatggaaaaaggaaatatacgaagagtcatcaacttggaaaggaaacaaagagtgcttttgggcatccaacagttaa
Sequence Length
567
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,944 Da
NCBI Official Full Name
Homo sapiens molybdenum cofactor synthesis 2, mRNA
NCBI Official Synonym Full Names
molybdenum cofactor synthesis 2
NCBI Official Symbol
MOCS2
NCBI Official Synonym Symbols
MPTS; MCBPE; MOCO1; MOCODB
NCBI Protein Information
molybdopterin synthase catalytic subunit; molybdopterin synthase sulfur carrier subunit
UniProt Protein Name
Molybdopterin synthase catalytic subunit
UniProt Gene Name
MOCS2
UniProt Synonym Gene Names
MOCS2B; MPT synthase large subunit
UniProt Entry Name
MOC2B_HUMAN

NCBI Description

Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. They are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]

Uniprot Description

MOCS2: Catalytic subunit of the molybdopterin synthase complex, a complex that catalyzes the conversion of precursor Z into molybdopterin. Acts by mediating the incorporation of 2 sulfur atoms from thiocarboxylated MOCS2A into precursor Z to generate a dithiolene group. Defects in MOCS2 are the cause of molybdenum cofactor deficiency type B (MOCOD type B). MOCOD type B is an autosomal recessive disease which leads to the pleiotropic loss of all molybdoenzyme activities and is characterized by severe neurological damage, neonatal seizures and early childhood death. Belongs to the MoaE family. MOCS2B subfamily.

Protein type: Enzyme, misc.; EC 2.8.1.12

Chromosomal Location of Human Ortholog: 5q11

Cellular Component: cytoplasm; cytosol; molybdopterin synthase complex; nucleus

Molecular Function: Mo-molybdopterin synthase activity

Biological Process: Mo-molybdopterin cofactor biosynthetic process; molybdopterin cofactor biosynthetic process

Disease: Molybdenum Cofactor Deficiency, Complementation Group B

Research Articles on MOCS2

Similar Products

Product Notes

The MOCS2 mocs2 (Catalog #AAA1274723) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgagct tggagatcag ctcctcgtgc ttcagcctgg agacgaaatt gccgttatcc cccccattag tggaggatag tgcttttgag ccatctagga aagatatgga tgaagttgaa gagaaatcta aagatgttat aaactttact gccgagaaac tttcagtaga tgaagtctca cagttggtga tttctccgct ctgtggtgca atatccctat ttgtagggac tacaagaaat aactttgaag ggaaaaaagt cattagctta gaatatgaag catatctacc catggcggaa aatgaagtca gaaagatttg tagtgacatt aggcagaaat ggccagtcaa acacatagca gtgttccata gacttggctt ggttccagtg tcagaagcaa gcataatcat tgctgtgtcc tcagcccaca gagctgcatc tcttgaagct gtgagctatg ccattgatac tttaaaagcc aaggtgccca tatggaaaaa ggaaatatac gaagagtcat caacttggaa aggaaacaaa gagtgctttt gggcatccaa cagttaa. It is sometimes possible for the material contained within the vial of "MOCS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.