Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MMP7 cdna clone

MMP7 cDNA Clone

Gene Names
MMP7; MMP-7; MPSL1; PUMP-1
Synonyms
MMP7; MMP7 cDNA Clone; MMP7 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgactcaccgtgctgtgtgctgtgtgcctgctgcctggcagcctggccctgccgctgcctcaggaggcgggaggcatgagtgagctacagtgggaacaggctcaggactatctcaagagattttatctctatgactcagaaacaaaaaatgccaacagtttagaagccaaactcaaggagatgcaaaaattctttggcctacctataactggaatgttaaactcccacgtcatagaaataatgcagaagcccagatgtggagtgccagatgttgcagaatactcactatttccaaatagcccaaaatggacttccaaagtggtcacctacaggatcgtatcatatactcgagacttaccgcatattacagtggatcgattagtgtcaaaggctttaaacatgtggggcaaagagatccccctgcatttcaggaaagttgtatggggaactgctgacatcatgattggctttgcgcgaggagctcatggggactcctacccatttgatgggccaggaaacacgctggctcatgcctttgcgcctgggacaggtctcggaggagatgctcacttcgatgaggatgaacgctggacggatggtagcagtctagggattaacttcctgtatgctgcaactcatgaacttggccattctttgggtatgggacattcctctgatcctaatgcagtgatgtatccaacctatggaaatggagatccccaaaattttaaactttcccaggatgatattaaaggcattcagaaactatatggaaagagaagtaattcaagaaagaaatag
Sequence Length
804
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,677 Da
NCBI Official Full Name
Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine), mRNA
NCBI Official Synonym Full Names
matrix metallopeptidase 7
NCBI Official Symbol
MMP7
NCBI Official Synonym Symbols
MMP-7; MPSL1; PUMP-1
NCBI Protein Information
matrilysin
UniProt Protein Name
Matrilysin
Protein Family
UniProt Gene Name
MMP7
UniProt Synonym Gene Names
MPSL1; PUMP1; MMP-7
UniProt Entry Name
MMP7_HUMAN

NCBI Description

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016]

Uniprot Description

MMP7: Degrades casein, gelatins of types I, III, IV, and V, and fibronectin. Activates procollagenase. Belongs to the peptidase M10A family.

Protein type: Protease; Secreted; EC 3.4.24.23; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11q22.2

Cellular Component: extracellular region

Molecular Function: serine-type endopeptidase activity

Biological Process: collagen catabolic process; extracellular matrix disassembly

Research Articles on MMP7

Similar Products

Product Notes

The MMP7 mmp7 (Catalog #AAA1268855) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgactca ccgtgctgtg tgctgtgtgc ctgctgcctg gcagcctggc cctgccgctg cctcaggagg cgggaggcat gagtgagcta cagtgggaac aggctcagga ctatctcaag agattttatc tctatgactc agaaacaaaa aatgccaaca gtttagaagc caaactcaag gagatgcaaa aattctttgg cctacctata actggaatgt taaactccca cgtcatagaa ataatgcaga agcccagatg tggagtgcca gatgttgcag aatactcact atttccaaat agcccaaaat ggacttccaa agtggtcacc tacaggatcg tatcatatac tcgagactta ccgcatatta cagtggatcg attagtgtca aaggctttaa acatgtgggg caaagagatc cccctgcatt tcaggaaagt tgtatgggga actgctgaca tcatgattgg ctttgcgcga ggagctcatg gggactccta cccatttgat gggccaggaa acacgctggc tcatgccttt gcgcctggga caggtctcgg aggagatgct cacttcgatg aggatgaacg ctggacggat ggtagcagtc tagggattaa cttcctgtat gctgcaactc atgaacttgg ccattctttg ggtatgggac attcctctga tcctaatgca gtgatgtatc caacctatgg aaatggagat ccccaaaatt ttaaactttc ccaggatgat attaaaggca ttcagaaact atatggaaag agaagtaatt caagaaagaa atag. It is sometimes possible for the material contained within the vial of "MMP7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.