Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MMP3 cdna clone

MMP3 cDNA Clone

Gene Names
MMP3; SL-1; STMY; STR1; CHDS6; MMP-3; STMY1
Synonyms
MMP3; MMP3 cDNA Clone; MMP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagagtcttccaatcctactgttgctgtgcgtggcagtttgctcagcctatccattggatggagctgcaaggggtgaggacaccagcatgaaccttgttcagaaatatctagaaaactactacgacctcgaaaaagatgtgaaacagtttgttaggagaaaggacagtggtcctgttgttaaaaaaatccgagaaatgcagaagttccttggattggaggtgacggggaagctggactccgacactctggaggtgatgcgcaagcccaggtgtggagttcctgacgttggtcacttcagaacctttcctggcatcccgaagtggaggaaaacccaccttacatacaggattgtgaattatacaccagatttgccaaaagatgctgttgattctgctgttgagaaagctctgaaagtctgggaagaggtgactccactcacattctccaggctgtatgaaggagaggctgatataatgatctcttttgcagttagagaacatggagacttttacccttttgatggacctggaaatgttttggcccatgcctatgcccctgggccagggattaatggagatgcccactttgatgatgatgaacaatggacaaaggatacaacagggaccaatttatttctcgttgctgctcatgaaattggccactccctgggtctctttcactcagccaacactgaagctttgatgtacccactctatcactcactcacagacctgactcggttccgcctgtctcaagatgatataaatggcattcagtccctctatggacctccccctgactcccctgagacccccctggtacccacggaacctgtccctccagaacctgggacgccagccaactgtgatcctgctttgtcctttgatgctgtcagcactctgaggggagaaatcctgatctttaaagacaggcacttttggcgcaaatccctcaggaagcttgaacctgaattgcatttgatctcttcattttggccatctcttccttcaggcgtggatgccgcatatgaagttactagcaaggacctcgttttcatttttaaaggaaatcaattctgggccatcagaggaaatgaggtacgagctggatacccaagaggcatccacaccctaggtttccctccaaccgtgaggaaaatcgatgcagccatttctgataaggaaaagaacaaaacatatttctttgtagaggacaaatactggagatttgatgagaagagaaattccatggagccaggctttcccaagcaaatagctgaagactttccagggattgactcaaagattgatgctgtttttgaagaatttgggttcttttatttctttactggatcttcacagttggagtttgacccaaatgcaaagaaagtgacacacactttgaagagtaacagctggcttaattgttga
Sequence Length
1434
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,977 Da
NCBI Official Full Name
Homo sapiens matrix metallopeptidase 3 (stromelysin 1, progelatinase), mRNA
NCBI Official Synonym Full Names
matrix metallopeptidase 3
NCBI Official Symbol
MMP3
NCBI Official Synonym Symbols
SL-1; STMY; STR1; CHDS6; MMP-3; STMY1
NCBI Protein Information
stromelysin-1
UniProt Protein Name
Stromelysin-1
Protein Family
UniProt Gene Name
MMP3
UniProt Synonym Gene Names
STMY1; SL-1; MMP-3
UniProt Entry Name
MMP3_HUMAN

NCBI Description

Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades fibronectin, laminin, collagens III, IV, IX, and X, and cartilage proteoglycans. The enzyme is thought to be involved in wound repair, progression of atherosclerosis, and tumor initiation. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]

Uniprot Description

MMP3: Can degrade fibronectin, laminin, gelatins of type I, III, IV, and V; collagens III, IV, X, and IX, and cartilage proteoglycans. Activates procollagenase. Defects in MMP3 are the cause of susceptibility to coronary heart disease type 6 (CHDS6). A multifactorial disease characterized by an imbalance between myocardial functional requirements and the capacity of the coronary vessels to supply sufficient blood flow. Decreased capacity of the coronary vessels is often associated with thickening and loss of elasticity of the coronary arteries. A polymorphism in the MMP3 promoter region is associated with the risk of coronary heart disease and myocardial infarction, due to lower MMP3 proteolytic activity and higher extracellular matrix deposition in atherosclerotic lesions. Belongs to the peptidase M10A family.

Protein type: EC 3.4.24.17; Motility/polarity/chemotaxis; Protease; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11q22.3

Cellular Component: extracellular region; extracellular space

Molecular Function: endopeptidase activity; metallopeptidase activity; protein binding; serine-type endopeptidase activity

Biological Process: collagen catabolic process; extracellular matrix disassembly; positive regulation of protein oligomerization; proteolysis

Disease: Coronary Heart Disease, Susceptibility To, 6

Research Articles on MMP3

Similar Products

Product Notes

The MMP3 mmp3 (Catalog #AAA1274190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagagtc ttccaatcct actgttgctg tgcgtggcag tttgctcagc ctatccattg gatggagctg caaggggtga ggacaccagc atgaaccttg ttcagaaata tctagaaaac tactacgacc tcgaaaaaga tgtgaaacag tttgttagga gaaaggacag tggtcctgtt gttaaaaaaa tccgagaaat gcagaagttc cttggattgg aggtgacggg gaagctggac tccgacactc tggaggtgat gcgcaagccc aggtgtggag ttcctgacgt tggtcacttc agaacctttc ctggcatccc gaagtggagg aaaacccacc ttacatacag gattgtgaat tatacaccag atttgccaaa agatgctgtt gattctgctg ttgagaaagc tctgaaagtc tgggaagagg tgactccact cacattctcc aggctgtatg aaggagaggc tgatataatg atctcttttg cagttagaga acatggagac ttttaccctt ttgatggacc tggaaatgtt ttggcccatg cctatgcccc tgggccaggg attaatggag atgcccactt tgatgatgat gaacaatgga caaaggatac aacagggacc aatttatttc tcgttgctgc tcatgaaatt ggccactccc tgggtctctt tcactcagcc aacactgaag ctttgatgta cccactctat cactcactca cagacctgac tcggttccgc ctgtctcaag atgatataaa tggcattcag tccctctatg gacctccccc tgactcccct gagacccccc tggtacccac ggaacctgtc cctccagaac ctgggacgcc agccaactgt gatcctgctt tgtcctttga tgctgtcagc actctgaggg gagaaatcct gatctttaaa gacaggcact tttggcgcaa atccctcagg aagcttgaac ctgaattgca tttgatctct tcattttggc catctcttcc ttcaggcgtg gatgccgcat atgaagttac tagcaaggac ctcgttttca tttttaaagg aaatcaattc tgggccatca gaggaaatga ggtacgagct ggatacccaa gaggcatcca caccctaggt ttccctccaa ccgtgaggaa aatcgatgca gccatttctg ataaggaaaa gaacaaaaca tatttctttg tagaggacaa atactggaga tttgatgaga agagaaattc catggagcca ggctttccca agcaaatagc tgaagacttt ccagggattg actcaaagat tgatgctgtt tttgaagaat ttgggttctt ttatttcttt actggatctt cacagttgga gtttgaccca aatgcaaaga aagtgacaca cactttgaag agtaacagct ggcttaattg ttga. It is sometimes possible for the material contained within the vial of "MMP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.