Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MLN cdna clone

MLN cDNA Clone

Synonyms
MLN; MLN cDNA Clone; MLN cdna clone
Ordering
For Research Use Only!
Sequence
ATGGTATCCCGTAAGGCTGTGGCTGCTCTGCTGGTGGTGCATGCAGCTGCCATGCTGGCCTCCCAGACGGAAGCCTTCGTCCCCATCTTCACCTATGGCGAACTCCAGAGGATGCAGGAAAAGGAACGGAATAAAGGGCAAAAGAAATCCCTGAGTGTATGGCAGAGGTCTGGGGAGGAAGGTCCTGTAGACCCTGCGGAGCCCATCAGGGAAGAAGAAAACGAAATGATCAAGCTGACTGCTCCTCTGGAAATTGGAATGAGGATGAACTCCAGACAGCTGGAAAAGTACCCGGCCACCCTGGAAGGGCTGCTGAGTGAGATGCTTCCCCAGCATGCAGCCAAGTGA
Sequence Length
348
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,849 Da
NCBI Official Full Name
Homo sapiens motilin, mRNA
NCBI Official Synonym Full Names
motilin
NCBI Official Symbol
MLN
NCBI Protein Information
promotilin
UniProt Protein Name
Promotilin
Protein Family
UniProt Gene Name
MLN
UniProt Synonym Gene Names
MAP
UniProt Entry Name
MOTI_HUMAN

NCBI Description

This gene encodes a small peptide hormone that is secreted by cells of the small intestine to regulate gastrointestinal contractions and motility. Proteolytic processing of the secreted protein produces the mature peptide and a byproduct referred to as motilin-associated peptide (MAP). Three transcript variants encoding different preproprotein isoforms but the same mature peptide have been found for this gene. [provided by RefSeq, May 2010]

Uniprot Description

MLN: Plays an important role in the regulation of interdigestive gastrointestinal motility and indirectly causes rhythmic contraction of duodenal and colonic smooth muscle. Belongs to the motilin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: extracellular region

Molecular Function: receptor binding

Biological Process: cell-cell signaling; G-protein coupled receptor protein signaling pathway

Research Articles on MLN

Similar Products

Product Notes

The MLN mln (Catalog #AAA1278089) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGTATCCC GTAAGGCTGT GGCTGCTCTG CTGGTGGTGC ATGCAGCTGC CATGCTGGCC TCCCAGACGG AAGCCTTCGT CCCCATCTTC ACCTATGGCG AACTCCAGAG GATGCAGGAA AAGGAACGGA ATAAAGGGCA AAAGAAATCC CTGAGTGTAT GGCAGAGGTC TGGGGAGGAA GGTCCTGTAG ACCCTGCGGA GCCCATCAGG GAAGAAGAAA ACGAAATGAT CAAGCTGACT GCTCCTCTGG AAATTGGAAT GAGGATGAAC TCCAGACAGC TGGAAAAGTA CCCGGCCACC CTGGAAGGGC TGCTGAGTGA GATGCTTCCC CAGCATGCAG CCAAGTGA. It is sometimes possible for the material contained within the vial of "MLN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.