MLLT6 cdna clone
MLLT6 cDNA Clone
Gene Names
MLLT6; AF17
Synonyms
MLLT6; MLLT6 cDNA Clone; MLLT6 cdna clone
Sequence
atgaaggagatggtaggaggctgctgcgtatgttcggacgagaggggctgggccgagaacccgctggtctactgcgatgggcacgcgtgcagcgtggccgtccaccaagcttgctatggcatcgttcaggtgccaacgggaccctggttctgccggaaatgtgaatctcaggagcgagcagccagggtgaggtgtgagctgtgcccacacaaagacggggcattgaagaggactgataatggaggctgggcacacgtggtgtgtgccctctacatccccgaggtgcaatttgccaacgtgctcaccatggagcccatcgtgctgcagtacgtgcctcatgatcgcttcaacaagacctgttacatctgcgaggagcagggccgggagagcaaggcggcctcgggagcctgcatgacctgtaaccgccatggatgtcgacaagccttccacgtcacctgtgcccaaatggcaggcttgctgtgtgaggaagaagtgctggaggtggacaacgtcaagtactgcggctactgcaaataccacttcagcaagatgaagacatcccggcacagcagcgggggaggcggaggaggcgctggaggaggaggtggcagcatggggggaggtggcagtggtttcatctctgggaggagaagccggtcagcctcaccatccacgcagcaggagaagcaccccacccaccacgagaggggccagaagaagagtcgaaaggacaaagaacgccttaagcagaagcacaagaagcggcctgagtcgccccccagcatcctcaccccgcccgtggtccccactgctgacaagcctagaaggggccaccaatcaccgaccaaccatgggattgggagtttggggtgctgtctgccagatactcccatctgcctctgtccagagggcctcagccctgggctcttgtctgcagagagtgggggacggcactcaggcctgctctccaagttctag
Sequence Length
978
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
112,076 Da
NCBI Official Full Name
Homo sapiens myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6, mRNA
NCBI Official Synonym Full Names
MLLT6, PHD finger domain containing
NCBI Official Symbol
MLLT6
NCBI Official Synonym Symbols
AF17
NCBI Protein Information
protein AF-17
UniProt Protein Name
Protein AF-17
Protein Family
UniProt Gene Name
MLLT6
UniProt Synonym Gene Names
AF17
UniProt Entry Name
AF17_HUMAN
Uniprot Description
MLLT6: A chromosomal aberration involving MLLT6 is associated with acute leukemias. Translocation t(11;17)(q23;q21) with MLL/HRX. The result is a rogue activator protein.
Protein type: Oncoprotein; Transcription factor
Chromosomal Location of Human Ortholog: 17q21
Molecular Function: protein binding
Biological Process: regulation of transcription, DNA-dependent
Research Articles on MLLT6
Similar Products
Product Notes
The MLLT6 mllt6 (Catalog #AAA1274996) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga tggtaggagg ctgctgcgta tgttcggacg agaggggctg ggccgagaac ccgctggtct actgcgatgg gcacgcgtgc agcgtggccg tccaccaagc ttgctatggc atcgttcagg tgccaacggg accctggttc tgccggaaat gtgaatctca ggagcgagca gccagggtga ggtgtgagct gtgcccacac aaagacgggg cattgaagag gactgataat ggaggctggg cacacgtggt gtgtgccctc tacatccccg aggtgcaatt tgccaacgtg ctcaccatgg agcccatcgt gctgcagtac gtgcctcatg atcgcttcaa caagacctgt tacatctgcg aggagcaggg ccgggagagc aaggcggcct cgggagcctg catgacctgt aaccgccatg gatgtcgaca agccttccac gtcacctgtg cccaaatggc aggcttgctg tgtgaggaag aagtgctgga ggtggacaac gtcaagtact gcggctactg caaataccac ttcagcaaga tgaagacatc ccggcacagc agcgggggag gcggaggagg cgctggagga ggaggtggca gcatgggggg aggtggcagt ggtttcatct ctgggaggag aagccggtca gcctcaccat ccacgcagca ggagaagcac cccacccacc acgagagggg ccagaagaag agtcgaaagg acaaagaacg ccttaagcag aagcacaaga agcggcctga gtcgcccccc agcatcctca ccccgcccgt ggtccccact gctgacaagc ctagaagggg ccaccaatca ccgaccaacc atgggattgg gagtttgggg tgctgtctgc cagatactcc catctgcctc tgtccagagg gcctcagccc tgggctcttg tctgcagaga gtgggggacg gcactcaggc ctgctctcca agttctag. It is sometimes possible for the material contained within the vial of "MLLT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
