Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MLANA cdna clone

MLANA cDNA Clone

Gene Names
MLANA; MART1; MART-1
Synonyms
MLANA; MLANA cDNA Clone; MLANA cdna clone
Ordering
For Research Use Only!
Sequence
atgccaagagaagatgctcacttcatctatggttaccccaagaaggggcacggccactcttacaccacggctgaagaggccgctgggatcggcatcctgacagtgatcctgggagtcttactgctcatcggctgttggtattgtagaagacgaaatggatacagagccttgatggataaaagtcttcatgttggcactcaatgtgccttaacaagaagatgcccacaagaagggtttgatcatcgggacagcaaagtgtctcttcaagagaaaaactgtgaacctgtggttcccaatgctccacctgcttatgagaaactctctgcagaacagtcaccaccaccttattcaccttaa
Sequence Length
357
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,157 Da
NCBI Official Full Name
Homo sapiens melan-A, mRNA
NCBI Official Synonym Full Names
melan-A
NCBI Official Symbol
MLANA
NCBI Official Synonym Symbols
MART1; MART-1
NCBI Protein Information
melanoma antigen recognized by T-cells 1
UniProt Protein Name
Melanoma antigen recognized by T-cells 1
UniProt Gene Name
MLANA
UniProt Synonym Gene Names
MART1; MART-1
UniProt Entry Name
MAR1_HUMAN

Uniprot Description

MLANA: Involved in melanosome biogenesis by ensuring the stability of GPR143. Plays a vital role in the expression, stability, trafficking, and processing of melanocyte protein PMEL, which is critical to the formation of stage II melanosomes.

Protein type: Membrane protein, integral; Cell surface

Chromosomal Location of Human Ortholog: 9p24.1

Cellular Component: endoplasmic reticulum membrane; Golgi apparatus; integral to plasma membrane; melanosome; trans-Golgi network

Molecular Function: protein binding

Research Articles on MLANA

Similar Products

Product Notes

The MLANA mlana (Catalog #AAA7046780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaagag aagatgctca cttcatctat ggttacccca agaaggggca cggccactct tacaccacgg ctgaagaggc cgctgggatc ggcatcctga cagtgatcct gggagtctta ctgctcatcg gctgttggta ttgtagaaga cgaaatggat acagagcctt gatggataaa agtcttcatg ttggcactca atgtgcctta acaagaagat gcccacaaga agggtttgat catcgggaca gcaaagtgtc tcttcaagag aaaaactgtg aacctgtggt tcccaatgct ccacctgctt atgagaaact ctctgcagaa cagtcaccac caccttattc accttaa. It is sometimes possible for the material contained within the vial of "MLANA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.