MKRN2 cdna clone
MKRN2 cDNA Clone
Synonyms
MKRN2; MKRN2 cDNA Clone; MKRN2 cdna clone
Sequence
atgagcaccaagcagatcacttgcaggtattttatgcatggtgtgtgtcgggaaggaagtcagtgcctattctcacatgacttggcaaacagcaaaccgtccaccatctgcaagtactaccagaagggctactgtgcctatggaactcggtgcagatatgaccacacgaggccctctgctgcagctggaggtgctgtgggcaccatggcccacagtgtgccctccccagctttccacagtcctcaccctccttccgaggtcactgcatccattgtgaaaactaactcacatgaacccggaaagcgtgaaaagagaacattggttcttagagaccgaaatctctctggcatggctgaaaggaagacccagccgagcatggtgagtaatccaggcagctgcagcgacccccagcccagccccgagatgaagccgcattcctacctggatgccatcaggagtggccttgatgacgtggaggccagcagctcctacagcaacgagcagcagctgtgcccctacgcagctgctggggagtgccggtttggggatgcctgtgtctacctgcacggggaggtgtgtgaaatctgtaggctgcaagtcttgcacccattcgacccagagcagaggaaggctcacgaaaagatctgcatgttgacgttcgaacacgagatggaaaaggcctttgccttccaggcaagccaggacaaagtgtgcagtatctgcatggaagtgatcctggagaaggcctctgcttctgagaggagatttgggattctctccaattgcaatcacacgtactgtttgtcctgcatccggcagtggcggtgtgccaaacagtttgaaaacccaatcattaagtcttgtccagaatgccgtgtgatatcagagtttgtaattccaagtgtgtattgggtggaagatcagaataaaaagaacgagttgattgaagctttcaaacaggggatggggaaaaaagcctgtaaatactttgagcaaggcaaggggacctgcccatttggaagcaaatgtctttatcgccatgcttaccccgatgggcggctagcagagcctgagaaacctcggaaacagctcagttctcaaggcactgtgaggttctttaattcagtgcggctctgggatttcatcgagaaccgagaaagccggcatgtccccaacaatgaagatgtcgacatgacagagctcggggacctcttcatgcacctttctggagtggaatcatcagaaccctaa
Sequence Length
1251
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,985 Da
NCBI Official Full Name
Homo sapiens makorin ring finger protein 2, mRNA
UniProt Protein Name
Probable E3 ubiquitin-protein ligase makorin-2
Protein Family
UniProt Gene Name
MKRN2
UniProt Synonym Gene Names
RNF62
UniProt Entry Name
MKRN2_HUMAN
Uniprot Description
MKRN2: E3 ubiquitin ligase catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins.
Protein type: EC 6.3.2.19; Ubiquitin conjugating system; EC 6.3.2.-; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 3p25
Cellular Component: intracellular
Molecular Function: protein binding
Similar Products
Product Notes
The MKRN2 mkrn2 (Catalog #AAA1266486) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacca agcagatcac ttgcaggtat tttatgcatg gtgtgtgtcg ggaaggaagt cagtgcctat tctcacatga cttggcaaac agcaaaccgt ccaccatctg caagtactac cagaagggct actgtgccta tggaactcgg tgcagatatg accacacgag gccctctgct gcagctggag gtgctgtggg caccatggcc cacagtgtgc cctccccagc tttccacagt cctcaccctc cttccgaggt cactgcatcc attgtgaaaa ctaactcaca tgaacccgga aagcgtgaaa agagaacatt ggttcttaga gaccgaaatc tctctggcat ggctgaaagg aagacccagc cgagcatggt gagtaatcca ggcagctgca gcgaccccca gcccagcccc gagatgaagc cgcattccta cctggatgcc atcaggagtg gccttgatga cgtggaggcc agcagctcct acagcaacga gcagcagctg tgcccctacg cagctgctgg ggagtgccgg tttggggatg cctgtgtcta cctgcacggg gaggtgtgtg aaatctgtag gctgcaagtc ttgcacccat tcgacccaga gcagaggaag gctcacgaaa agatctgcat gttgacgttc gaacacgaga tggaaaaggc ctttgccttc caggcaagcc aggacaaagt gtgcagtatc tgcatggaag tgatcctgga gaaggcctct gcttctgaga ggagatttgg gattctctcc aattgcaatc acacgtactg tttgtcctgc atccggcagt ggcggtgtgc caaacagttt gaaaacccaa tcattaagtc ttgtccagaa tgccgtgtga tatcagagtt tgtaattcca agtgtgtatt gggtggaaga tcagaataaa aagaacgagt tgattgaagc tttcaaacag gggatgggga aaaaagcctg taaatacttt gagcaaggca aggggacctg cccatttgga agcaaatgtc tttatcgcca tgcttacccc gatgggcggc tagcagagcc tgagaaacct cggaaacagc tcagttctca aggcactgtg aggttcttta attcagtgcg gctctgggat ttcatcgaga accgagaaag ccggcatgtc cccaacaatg aagatgtcga catgacagag ctcggggacc tcttcatgca cctttctgga gtggaatcat cagaacccta a. It is sometimes possible for the material contained within the vial of "MKRN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
