MINA cdna clone
MINA cDNA Clone
Gene Names
MINA; ROX; MDIG; NO52; MINA53
Synonyms
MINA; MINA cDNA Clone; MINA cdna clone
Sequence
atgccaaagaaagcaaagcctacagggagtgggaaggaagaggggccggctccctgtaagcagatgaagttagaagcagctggggggccttcagctttaaactttgacagtcccagtagtctctttgaaagtttaatctcgcccatcaagacagagacttttttcaaggaattctgggagcagaagccccttctcattcagagagatgaccctgcactggccacatactatgggtccctgttcaagctaacagatctgaagagtctgtgcagccgggggatgtactatggaagagatgtgaatgtctgccggtgtgtcaatgggaagaagaaggttttaaataaagatggcaaagcacactttcttcagctgagaaaagattttgatcagaaaagggcaacgattcagtttcaccaacctcagagatttaaggatgagctttggaggatccaggagaagctggaatgttactttggctccttggttggctcgaatgtgtacataactcccgcaggatctcagggcctgccgccccattatgatgatgtcgaggttttcatcctgcagctggagggagagaaacactggcgcctctaccaccccactgtgcccctggcacgagagtacagcgtggaggccgaggaaaggatcggcaggccggtgcatgagtttatgctgaagccgggtgatttgttgtactttcccagaggaaccattcatcaagcggacactcctgcggggctggcccactcgactcacgtgaccatcagcacctaccagaacaattcatggggagatttccttttggataccatctcggggcttgtatttgatactgcaaaggaagacgtggagttacggaccggcataccccggcagctgctcctgcaggtggaatccacaactgttgctacaagacgattaagtggcttcctgaggacacttgcagaccggctggagggcaccaaagaactgctttcctcagacatgaagaaggattttattatgcacagactccccccttactctgcgggagatggggcagagctgtcaacaccaggtggaaagttaccgaggctggacagtgtagtgagactgcagtttaaagaccacattgtcctcacagtactgccggatcaagatcaatctgatgaaactcaagaaaagatggtgtacatctatcattccttaaagaatagtagagagacacacatgatgggaaatgaggaggaaacagagtttcatggacttcgcttccctttgtcacatttggatgcactgaagcaaatttggaatagtccagctatttctgtcaaggacctgaaacttactacagatgaggaaaaggaaagcctggtattatccctctggacagaatgtttaattcaagtagtctag
Sequence Length
1398
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,672 Da
NCBI Official Full Name
Homo sapiens MYC induced nuclear antigen, mRNA
NCBI Official Synonym Full Names
MYC induced nuclear antigen
NCBI Official Symbol
MINA
NCBI Official Synonym Symbols
ROX; MDIG; NO52; MINA53
NCBI Protein Information
bifunctional lysine-specific demethylase and histidyl-hydroxylase MINA
UniProt Protein Name
Bifunctional lysine-specific demethylase and histidyl-hydroxylase MINA
UniProt Gene Name
MINA
UniProt Synonym Gene Names
ROX
UniProt Entry Name
MINA_HUMAN
NCBI Description
MINA is a c-Myc (MYC; MIM 190080) target gene that may play a role in cell proliferation or regulation of cell growth. (Tsuneoka et al., 2002 [PubMed 12091391]; Zhang et al., 2005 [PubMed 15897898]).[supplied by OMIM, May 2008]
Uniprot Description
MINA: Involved in cellular proliferation. May play an important role in cell growth and survival. May be involved in ribosome biogenesis, most likely during the assembly process of pre-ribosomal particles. Belongs to the MINA53/NO66 family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 3q11.2
Cellular Component: cytoplasm; nucleolus; nucleus
Molecular Function: iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors
Biological Process: negative regulation of transcription, DNA-dependent; peptidyl-amino acid modification; post-translational protein modification; ribosome biogenesis and assembly
Research Articles on MINA
Similar Products
Product Notes
The MINA mina (Catalog #AAA1268144) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaaaga aagcaaagcc tacagggagt gggaaggaag aggggccggc tccctgtaag cagatgaagt tagaagcagc tggggggcct tcagctttaa actttgacag tcccagtagt ctctttgaaa gtttaatctc gcccatcaag acagagactt ttttcaagga attctgggag cagaagcccc ttctcattca gagagatgac cctgcactgg ccacatacta tgggtccctg ttcaagctaa cagatctgaa gagtctgtgc agccggggga tgtactatgg aagagatgtg aatgtctgcc ggtgtgtcaa tgggaagaag aaggttttaa ataaagatgg caaagcacac tttcttcagc tgagaaaaga ttttgatcag aaaagggcaa cgattcagtt tcaccaacct cagagattta aggatgagct ttggaggatc caggagaagc tggaatgtta ctttggctcc ttggttggct cgaatgtgta cataactccc gcaggatctc agggcctgcc gccccattat gatgatgtcg aggttttcat cctgcagctg gagggagaga aacactggcg cctctaccac cccactgtgc ccctggcacg agagtacagc gtggaggccg aggaaaggat cggcaggccg gtgcatgagt ttatgctgaa gccgggtgat ttgttgtact ttcccagagg aaccattcat caagcggaca ctcctgcggg gctggcccac tcgactcacg tgaccatcag cacctaccag aacaattcat ggggagattt ccttttggat accatctcgg ggcttgtatt tgatactgca aaggaagacg tggagttacg gaccggcata ccccggcagc tgctcctgca ggtggaatcc acaactgttg ctacaagacg attaagtggc ttcctgagga cacttgcaga ccggctggag ggcaccaaag aactgctttc ctcagacatg aagaaggatt ttattatgca cagactcccc ccttactctg cgggagatgg ggcagagctg tcaacaccag gtggaaagtt accgaggctg gacagtgtag tgagactgca gtttaaagac cacattgtcc tcacagtact gccggatcaa gatcaatctg atgaaactca agaaaagatg gtgtacatct atcattcctt aaagaatagt agagagacac acatgatggg aaatgaggag gaaacagagt ttcatggact tcgcttccct ttgtcacatt tggatgcact gaagcaaatt tggaatagtc cagctatttc tgtcaaggac ctgaaactta ctacagatga ggaaaaggaa agcctggtat tatccctctg gacagaatgt ttaattcaag tagtctag. It is sometimes possible for the material contained within the vial of "MINA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
