Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED4 cdna clone

MED4 cDNA Clone

Gene Names
MED4; ARC36; VDRIP; DRIP36; TRAP36; HSPC126
Synonyms
MED4; MED4 cDNA Clone; MED4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcgtcttcgagtggtgagaaggagaaggagcggctgggaggcggtttgggagtggcgggtggtaacagcacacgagagcggctgctgtctgcgcttgaggacttggaggtcctgtctagggaacttatagaaatgctggcaatttcaagaaaccagaagttgttacaggctggagaggaaaaccaggtcctggagttgttaattcaccgagatggggaatttcaagaactaatgaaattggcacttaatcagggaaaaattcatcatgaaatgcaagttttagaaaaagaagtagagaagagagacggtgatattcagcagctacaaaaacagctaaaggaagcagaacaaatactggcaacagctgtttaccaagcgaaggagaaactcaagtcaatagaaaaagcaagaaaaggtgctatctcctctgaagaaataattaagtatgcacataggatcagtgcaagtaatgctgtatgtgctccactgacctgggttccaggggacccccggagaccctacccaactgatttagagatgagaagtgggttactgggtcagatgaacaatccttccactaatggcgtgaatggccatttaccaggagatgcacttgcagcaggaagattgccagatgtccttgctccacagtatccatggcagtcaaatgacatgtcgatgaatatgttaccaccaaatcatagtagtgactttttgttggaacctcctgggcataataaagaagatgaagatgatgtagagattatgtcaacggactcctcaagcagtagtagtgagtctgattga
Sequence Length
813
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,947 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 4, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 4
NCBI Official Symbol
MED4
NCBI Official Synonym Symbols
ARC36; VDRIP; DRIP36; TRAP36; HSPC126
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 4
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 4
UniProt Gene Name
MED4
UniProt Synonym Gene Names
ARC36; DRIP36; VDRIP; ARC36; DRIP36
UniProt Entry Name
MED4_HUMAN

NCBI Description

This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

MED4: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Belongs to the Mediator complex subunit 4 family.

Chromosomal Location of Human Ortholog: 13q14.2

Cellular Component: membrane; nucleoplasm; nucleus; Srb-mediator complex

Molecular Function: protein binding; receptor activity; thyroid hormone receptor binding; transcription cofactor activity

Biological Process: androgen receptor signaling pathway; positive regulation of transcription, DNA-dependent; steroid hormone receptor signaling pathway; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on MED4

Similar Products

Product Notes

The MED4 med4 (Catalog #AAA1271006) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgt cttcgagtgg tgagaaggag aaggagcggc tgggaggcgg tttgggagtg gcgggtggta acagcacacg agagcggctg ctgtctgcgc ttgaggactt ggaggtcctg tctagggaac ttatagaaat gctggcaatt tcaagaaacc agaagttgtt acaggctgga gaggaaaacc aggtcctgga gttgttaatt caccgagatg gggaatttca agaactaatg aaattggcac ttaatcaggg aaaaattcat catgaaatgc aagttttaga aaaagaagta gagaagagag acggtgatat tcagcagcta caaaaacagc taaaggaagc agaacaaata ctggcaacag ctgtttacca agcgaaggag aaactcaagt caatagaaaa agcaagaaaa ggtgctatct cctctgaaga aataattaag tatgcacata ggatcagtgc aagtaatgct gtatgtgctc cactgacctg ggttccaggg gacccccgga gaccctaccc aactgattta gagatgagaa gtgggttact gggtcagatg aacaatcctt ccactaatgg cgtgaatggc catttaccag gagatgcact tgcagcagga agattgccag atgtccttgc tccacagtat ccatggcagt caaatgacat gtcgatgaat atgttaccac caaatcatag tagtgacttt ttgttggaac ctcctgggca taataaagaa gatgaagatg atgtagagat tatgtcaacg gactcctcaa gcagtagtag tgagtctgat tga. It is sometimes possible for the material contained within the vial of "MED4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.