Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED27 cdna clone

MED27 cDNA Clone

Gene Names
MED27; MED3; CRSP8; CRAP34; CRSP34; TRAP37
Synonyms
MED27; MED27 cDNA Clone; MED27 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggaacaaggagacgctggagggccgggagaaggcctttattgcgcacttccaggacaacttacattcggtcaaccgggacctcaatgagctggaacgtctgagcaatctggtaggcaagccatctgagaaccatcctcttcataacagtgggctgttaagcctggatcctgtgcaggacaaaactcctctctatagtcaactcctttaa
Sequence Length
213
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,826 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 27, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 27
NCBI Official Symbol
MED27
NCBI Official Synonym Symbols
MED3; CRSP8; CRAP34; CRSP34; TRAP37
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 27
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 27
UniProt Gene Name
MED27
UniProt Synonym Gene Names
; CRSP complex subunit 8
UniProt Entry Name
MED27_HUMAN

NCBI Description

The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]

Uniprot Description

MED27: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Belongs to the Mediator complex subunit 27 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 9q34.13

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus; transcription factor complex

Molecular Function: protein binding; transcription coactivator activity

Biological Process: regulation of transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on MED27

Similar Products

Product Notes

The MED27 med27 (Catalog #AAA1267818) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggaaca aggagacgct ggagggccgg gagaaggcct ttattgcgca cttccaggac aacttacatt cggtcaaccg ggacctcaat gagctggaac gtctgagcaa tctggtaggc aagccatctg agaaccatcc tcttcataac agtgggctgt taagcctgga tcctgtgcag gacaaaactc ctctctatag tcaactcctt taa. It is sometimes possible for the material contained within the vial of "MED27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.