Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCHR1 cdna clone

MCHR1 cDNA Clone

Gene Names
MCHR1; SLC1; GPR24; MCH1R; SLC-1; MCH-1R
Synonyms
MCHR1; MCHR1 cDNA Clone; MCHR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctcggttgtgggagcaggcgaccggcactggctggatggacctggaagcctcgctgctgcccactggtcccaatgccagcaacacctctgatggccccgataacctcacttcggcaggatcacctcctcgcacggggagcatctcctacatcaacatcatcatgccttcggtgttcggcaccatctgcctcctgggcatcatcgggaactccacggtcatcttcgcggtcgtgaagaagtccaagctgcactggtgcaacaacgtccccgacatcttcatcatcaacctctcggtagtagatctcctctttctcctgggcatgcccttcatgatccaccagctcatgggcaatggggtgtggcactttggggagaccatgtgcaccctcatcacggccatggatgccaatagtcagttcaccagcacctacatcctgaccgccatggccattgaccgctacctggccactgtccaccccatctcttccacgaagttccggaagccctctgtggccaccctggtgatctgcctcctgtgggccctctccttcatcagcatcacccctgtgtggctgtatgccagactcatccccttcccaggaggtgcagtgggctgcggcatacgcctgcccaacccagacactgacctctactggttcaccctgtaccagtttttcctggcctttgccctgccttttgtggtcatcacagccgcatacgtgaggatcctgcagcgcatgacgtcctcagtggcccccgcctcccagcgcagcatccggctgcggacaaagagggtgacccgcacagccatcgccatctgtctggtcttctttgtgtgctgggcaccctactatgtgctacagctgacccagttgtccatcagccgcccgaccctcacctttgtctacttatacaatgcggccatcagcttgggctatgccaacagctgcctcaacccctttgtgtacatcgtgctctgtgagacgttccgcaaacgcttggtcctgtcggtgaagcctgcagcccaggggcagcttcgcgctgtcagcaacgctcagacggctgacgaggagaggacagaaagcaaaggcacctga
Sequence Length
1269
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,963 Da
NCBI Official Full Name
Homo sapiens melanin-concentrating hormone receptor 1, mRNA
NCBI Official Synonym Full Names
melanin concentrating hormone receptor 1
NCBI Official Symbol
MCHR1
NCBI Official Synonym Symbols
SLC1; GPR24; MCH1R; SLC-1; MCH-1R
NCBI Protein Information
melanin-concentrating hormone receptor 1
UniProt Protein Name
Melanin-concentrating hormone receptor 1
UniProt Gene Name
MCHR1
UniProt Synonym Gene Names
GPR24; SLC1; MCH receptor 1; MCH-R1; MCHR-1; MCH1R; MCHR
UniProt Entry Name
MCHR1_HUMAN

NCBI Description

The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]

Uniprot Description

MCHR1: Receptor for melanin-concentrating hormone, coupled to both G proteins that inhibit adenylyl cyclase and G proteins that activate phosphoinositide hydrolysis. Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Receptor, GPCR; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 22q13.2

Cellular Component: integral to plasma membrane; nonmotile primary cilium; plasma membrane

Molecular Function: G-protein coupled receptor activity; melanin-concentrating hormone receptor activity; neuropeptide receptor activity

Biological Process: cell surface receptor linked signal transduction; elevation of cytosolic calcium ion concentration; feeding behavior; G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; generation of precursor metabolites and energy

Research Articles on MCHR1

Similar Products

Product Notes

The MCHR1 mchr1 (Catalog #AAA1276280) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagtgg gagccatgaa gaagggagtg gggagggcag ttgggcttgg aggcggcagc ggctgccagg ctacggagga agaccccctt cccgactgcg gggcttgcgc tccgggacaa ggtggcaggc gctggaggct gccgcagcct gcgtgggtgg aggggagctc agctcggttg tgggagcagg cgaccggcac tggctggatg gacctggaag cctcgctgct gcccactggt cccaatgcca gcaacacctc tgatggcccc gataacctca cttcggcagg atcacctcct cgcacgggga gcatctccta catcaacatc atcatgcctt cggtgttcgg caccatctgc ctcctgggca tcatcgggaa ctccacggtc atcttcgcgg tcgtgaagaa gtccaagctg cactggtgca acaacgtccc cgacatcttc atcatcaacc tctcggtagt agatctcctc tttctcctgg gcatgccctt catgatccac cagctcatgg gcaatggggt gtggcacttt ggggagacca tgtgcaccct catcacggcc atggatgcca atagtcagtt caccagcacc tacatcctga ccgccatggc cattgaccgc tacctggcca ctgtccaccc catctcttcc acgaagttcc ggaagccctc tgtggccacc ctggtgatct gcctcctgtg ggccctctcc ttcatcagca tcacccctgt gtggctgtat gccagactca tccccttccc aggaggtgca gtgggctgcg gcatacgcct gcccaaccca gacactgacc tctactggtt caccctgtac cagtttttcc tggcctttgc cctgcctttt gtggtcatca cagccgcata cgtgaggatc ctgcagcgca tgacgtcctc agtggccccc gcctcccagc gcagcatccg gctgcggaca aagagggtga cccgcacagc catcgccatc tgtctggtct tctttgtgtg ctgggcaccc tactatgtgc tacagctgac ccagttgtcc atcagccgcc cgaccctcac ctttgtctac ttatacaatg cggccatcag cttgggctat gccaacagct gcctcaaccc ctttgtgtac atcgtgctct gtgagacgtt ccgcaaacgc ttggtcctgt cggtgaagcc tgcagcccag gggcagcttc gcgctgtcag caacgctcag acggctgacg aggagaggac agaaagcaaa ggcacctga. It is sometimes possible for the material contained within the vial of "MCHR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.