Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MBNL1 cdna clone

MBNL1 cDNA Clone

Gene Names
MBNL1; EXP; MBNL
Synonyms
MBNL1; MBNL1 cDNA Clone; MBNL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggccgttgctccagggagaactgcaaatatcttcatccacccccacatttaaaaacgcagttggagataaatggacgcaataacttgattcagcagaagaacatggccatgttggcccagcaaatgcaactagccaatgccatgatgcctggtgccccattacaacccgtgccaatgttttcagttgcaccaagcttagccaccaatgcatcagcagccgcctttaatccctatctgggacctgtttctccaagcctggtcccggcagagatcttgccgactgcaccaatgttggttacagggaatccgggtgtccctgtacctgcagctgctgcagctgctgcacagaaattaatgcgaacagacagacttgaggtatgtcgagagtaccaacgtggcaattgcaaccgaggagaaaatgattgtcggtttgctcatcctgctgacagcacaatgattgacaccaatgacaacacagtcactgtgtgtatggattacatcaaagggagatgctctcgggaaaagtgcaaatactttcatccccctgcacatttgcaagccaagatcaaggctgcccaataccaggtcaaccaggctgcagctgcacaggctgcagccaccgcagctgccatgactcagtcggctgtcaaatcactgaagcgacccctcgaggcaacctttgacctgggaattcctcaagctgtacttcccccattaccaaagaggcctgctcttgaaaaaaccaacggtgccaccgcagtctttaacactggtattttccaataccaacaggctctagccaacatgcagttacaacagcatacagcatttctcccaccaggctcaatattgtgcatgacacccgctacaagtgttgttcccatggtgcacggtgctacgccagccactgtgtccgcagcaacaacatctgccacaagtgttcccttcgctgcaacagccacagccaaccagatacccataatatctgccgaacatctgactagccacaagtatgttacccagatgtag
Sequence Length
1032
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,992 Da
NCBI Official Full Name
Homo sapiens muscleblind-like (Drosophila), mRNA
NCBI Official Synonym Full Names
muscleblind like splicing regulator 1
NCBI Official Symbol
MBNL1
NCBI Official Synonym Symbols
EXP; MBNL
NCBI Protein Information
muscleblind-like protein 1
UniProt Protein Name
Muscleblind-like protein 1
Protein Family
UniProt Gene Name
MBNL1
UniProt Synonym Gene Names
EXP; KIAA0428; MBNL
UniProt Entry Name
MBNL1_HUMAN

NCBI Description

This gene encodes a member of the muscleblind protein family which was initially described in Drosophila melanogaster. The encoded protein is a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Mice lacking this gene exhibited muscle abnormalities and cataracts. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. The different isoforms are thought to have different binding specificities and/or splicing activities. [provided by RefSeq, Sep 2015]

Uniprot Description

MBNL1: Mediates pre-mRNA alternative splicing regulation. Acts either as activator or repressor of splicing on specific pre-mRNA targets. Inhibits cardiac troponin-T (TNNT2) pre-mRNA exon inclusion but induces insulin receptor (IR) pre-mRNA exon inclusion in muscle. Antagonizes the alternative splicing activity pattern of CELF proteins. Regulates the TNNT2 exon 5 skipping through competition with U2AF2. Inhibits the formation of the spliceosome A complex on intron 4 of TNNT2 pre-mRNA. Binds to the stem-loop structure within the polypyrimidine tract of TNNT2 intron 4 during spliceosome assembly. Binds to the 5'-YGCU(U/G)Y- 3'consensus sequence. Binds to the IR RNA. Binds to expanded CUG repeat RNA, which folds into a hairpin structure containing GC base pairs and bulged, unpaired U residues. Plays a role in the pathogenesis of dystrophia myotonica type 1 (DM1). A muscular disorder characterized by myotonia, muscle wasting in the distal extremities, cataract, hypogonadism, defective endocrine functions, male baldness and cardiac arrhythmias. In muscle cells from DM1 patients, MBNL1 is sequestered by DMPK RNAs containing CUG triplet repeat expansions. MBNL1 binding is proportional to repeat length consistent with the direct correlation between the length of repeat expansion and disease severity. Belongs to the muscleblind family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 3q25

Cellular Component: centrosome; cytoplasm; nucleoplasm; nucleus; stress granule

Molecular Function: double-stranded RNA binding; protein binding; RNA binding

Biological Process: embryonic limb morphogenesis; in utero embryonic development; myoblast differentiation; nervous system development; regulation of RNA splicing; RNA splicing

Research Articles on MBNL1

Similar Products

Product Notes

The MBNL1 mbnl1 (Catalog #AAA1278178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccgtt gctccaggga gaactgcaaa tatcttcatc cacccccaca tttaaaaacg cagttggaga taaatggacg caataacttg attcagcaga agaacatggc catgttggcc cagcaaatgc aactagccaa tgccatgatg cctggtgccc cattacaacc cgtgccaatg ttttcagttg caccaagctt agccaccaat gcatcagcag ccgcctttaa tccctatctg ggacctgttt ctccaagcct ggtcccggca gagatcttgc cgactgcacc aatgttggtt acagggaatc cgggtgtccc tgtacctgca gctgctgcag ctgctgcaca gaaattaatg cgaacagaca gacttgaggt atgtcgagag taccaacgtg gcaattgcaa ccgaggagaa aatgattgtc ggtttgctca tcctgctgac agcacaatga ttgacaccaa tgacaacaca gtcactgtgt gtatggatta catcaaaggg agatgctctc gggaaaagtg caaatacttt catccccctg cacatttgca agccaagatc aaggctgccc aataccaggt caaccaggct gcagctgcac aggctgcagc caccgcagct gccatgactc agtcggctgt caaatcactg aagcgacccc tcgaggcaac ctttgacctg ggaattcctc aagctgtact tcccccatta ccaaagaggc ctgctcttga aaaaaccaac ggtgccaccg cagtctttaa cactggtatt ttccaatacc aacaggctct agccaacatg cagttacaac agcatacagc atttctccca ccaggctcaa tattgtgcat gacacccgct acaagtgttg ttcccatggt gcacggtgct acgccagcca ctgtgtccgc agcaacaaca tctgccacaa gtgttccctt cgctgcaaca gccacagcca accagatacc cataatatct gccgaacatc tgactagcca caagtatgtt acccagatgt ag. It is sometimes possible for the material contained within the vial of "MBNL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.