Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAT2B cdna clone

MAT2B cDNA Clone

Gene Names
MAT2B; TGR; MAT-II; SDR23E1; MATIIbeta; Nbla02999
Synonyms
MAT2B; MAT2B cDNA Clone; MAT2B cdna clone
Ordering
For Research Use Only!
Sequence
atggtggggcgggagaaagagctctctatacactttgttcccgggagctgtcggctggtggaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtggtttcagaagagcaagaccaaaatttgaacaggttaatctgttggattctaatgcagttcatcacatcattcatgattttcagccccatgttatagtacattgtgcagcagagagaagaccagatgttgtagaaaatcagccagatgctgcctctcaacttaatgtggatgcttctgggaatttagcaaaggaagcagctgctgttggagcatttctcatctacattagctcagattatgtatttgatggaacaaatccaccttacagagaggaagacataccagctcccctaaatttgtatggcaaaacaaaattagatggagaaaaggctgtcctggagaacaatctaggagctgctgttttgaggattcctattctgtatggggaagttgaaaagctcgaagaaagtgctgtgactgttatgtttgataaagtgcagttcagcaacaagtcagcaaacatggatcactggcagcagaggttccccacacatgtcaaagatgtggccactgtgtgccggcagctagcagagaagagaatgctggatccatcaattaagggaacctttcactggtctggcaatgaacagatgactaagtatgaaatggcatgtgcaattgcagatgccttcaacctccccagcagtcacttaagacctattactgacagccctgtcctaggagcacaacgtccgagaaatgctcagcttgactgctccaaattggagatcttgggcattggccaacgaacaccatttcgaattggaatcaaagaatcactttggcctttcctcattgacaagagatggagacaaacggtctttcattag
Sequence Length
1005
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,488 Da
NCBI Official Full Name
Homo sapiens methionine adenosyltransferase II, beta, mRNA
NCBI Official Synonym Full Names
methionine adenosyltransferase 2B
NCBI Official Symbol
MAT2B
NCBI Official Synonym Symbols
TGR; MAT-II; SDR23E1; MATIIbeta; Nbla02999
NCBI Protein Information
methionine adenosyltransferase 2 subunit beta
UniProt Protein Name
Methionine adenosyltransferase 2 subunit beta
UniProt Gene Name
MAT2B
UniProt Synonym Gene Names
TGR; MAT II beta
UniProt Entry Name
MAT2B_HUMAN

NCBI Description

The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]

Uniprot Description

MAT2B: Non-catalytic regulatory subunit of S-adenosylmethionine synthetase 2 (MAT2A), an enzyme that catalyzes the formation of S- adenosylmethionine from methionine and ATP. Regulates the activity of S-adenosylmethionine synthetase 2 by changing its kinetic properties, rendering the enzyme more susceptible to S- adenosylmethionine inhibition. Belongs to the dTDP-4-dehydrorhamnose reductase family. MAT2B subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - cysteine and methionine; Other Amino Acids Metabolism - selenoamino acid; Transferase

Chromosomal Location of Human Ortholog: 5q34

Cellular Component: cytosol; intracellular; methionine adenosyltransferase complex; nucleus

Molecular Function: enzyme binding; methionine adenosyltransferase regulator activity; protein binding

Biological Process: methylation; S-adenosylmethionine biosynthetic process

Research Articles on MAT2B

Similar Products

Product Notes

The MAT2B mat2b (Catalog #AAA1277722) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggggc gggagaaaga gctctctata cactttgttc ccgggagctg tcggctggtg gaggaggaag ttaacatccc taataggagg gttctggtta ctggtgccac tgggcttctt ggcagagctg tacacaaaga atttcagcag aataattggc atgcagttgg ctgtggtttc agaagagcaa gaccaaaatt tgaacaggtt aatctgttgg attctaatgc agttcatcac atcattcatg attttcagcc ccatgttata gtacattgtg cagcagagag aagaccagat gttgtagaaa atcagccaga tgctgcctct caacttaatg tggatgcttc tgggaattta gcaaaggaag cagctgctgt tggagcattt ctcatctaca ttagctcaga ttatgtattt gatggaacaa atccacctta cagagaggaa gacataccag ctcccctaaa tttgtatggc aaaacaaaat tagatggaga aaaggctgtc ctggagaaca atctaggagc tgctgttttg aggattccta ttctgtatgg ggaagttgaa aagctcgaag aaagtgctgt gactgttatg tttgataaag tgcagttcag caacaagtca gcaaacatgg atcactggca gcagaggttc cccacacatg tcaaagatgt ggccactgtg tgccggcagc tagcagagaa gagaatgctg gatccatcaa ttaagggaac ctttcactgg tctggcaatg aacagatgac taagtatgaa atggcatgtg caattgcaga tgccttcaac ctccccagca gtcacttaag acctattact gacagccctg tcctaggagc acaacgtccg agaaatgctc agcttgactg ctccaaattg gagatcttgg gcattggcca acgaacacca tttcgaattg gaatcaaaga atcactttgg cctttcctca ttgacaagag atggagacaa acggtctttc attag. It is sometimes possible for the material contained within the vial of "MAT2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.