Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPK7 cdna clone

MAPK7 cDNA Clone

Gene Names
MAPK7; BMK1; ERK4; ERK5; PRKM7
Synonyms
MAPK7; MAPK7 cDNA Clone; MAPK7 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaagcgacctgcaccagatcatccactcctcacagcccctcacactggaacacgtgcgctacttcctgtaccaactgctgcggggcctgaagtacatgcactcggctcaggtcatccaccgtgacctgaagccctccaacctattggtgaatgagaactgtgagctcaagattggtgactttggtatggctcgtggcctgtgcacctcgcccgctgaacatcagtacttcatgactgagtatgtggccacgcgctggtaccgtgcgcccgagctcatgctctctttgcatgagtatacacaggctattgacctctggtctgtgggctgcatctttggtgagatgctggcccggcgccagctcttcccaggcaaaaactatgtacaccagctacagctcatcatgatggtgctgggtaccccatcaccagccgtgattcaggctgtgggggctgagagggtgcgggcctatatccagagcttgccaccacgccagcctgtgccctgggagacagtgtacccaggtgccgaccgccaggccctatcactgctgggtcgcatgctgcgttttgagcccagcgctcgcatctcagcagctgctgcccttcgccaccctttcctggccaagtaccatgatcctgatgatgagcctgactgtgccccgccctttgactttgcctttgaccgcgaagccctcactcgggagcgcattaaggaggccattgtggctgaaattgaggacttccatgcaaggcgtgagggcatccgccaacagatccgcttccagccttctctacagcctgtggctagtgagcctggctgtccagatgttgaaatgcccagtccctgggctcccagtggggactgtgccatggagtctccaccaccagccccgccaccatgccccggccctgcacctgacaccattgatctgaccctgcagccacctccaccagtcagtgagcctgccccaccaaagaaagatggtgccatctcagacaatactaaggctgcccttaaagctgccctgctcaagtctttgaggagccggctcagagatggccccagcgcacccctggaggctcctgagcctcggaagccggtgacagcccaggagcgccagcgggagcgggaggagaagcggcggaggcggcaagaacgagccaaggagcgggagaaacggcggcaggagcgggagcgaaaggaacggggggctggggcctctgggggcccctccactgaccccttggctggactagtgctcagtgacaatgacagaagcctgttggaacgctggactcgaatggcccggcccgcagccccagccctcacctctgtgccggcccctgccccagcgccaacgccaaccccaaccccagtccaacctaccagtcctcctcctggccctgtagcccagcccactggcccgcaaccacaatctgcgggctctacctctggccctgtaccccagcctgcctgcccaccccctggccctgcaccccaccccactggccctcctgggcccatccctgtccccgcgccaccccagattgccacctccaccagcctcctggctgcccagtcacttgtgccaccccctgggctgcctggctccagcaccccaggagttttgccttacttcccacctggcctgccgcccccagacgccgggggagcccctcagtcttccatgtcagagtcacctgatgtcaaccttgtgacccagcagctatctaagtcacaggtggaggaccccctgccccctgtgttctcaggcacaccaaagggcagtggggctggctacggtgttggctttgacctggaggaattcttaaaccagtctttcgacatgggcgtggctgatgggccacaggatggccaggcagattcagcctctctctcagcctccctgcttgctgactggctcgaaggccatggcatgaaccctgccgatattgagtccctgcagcgtgagatccagatggactccccaatgctgctggctgacctgcctgacctccaggacccctga
Sequence Length
2034
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,152 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 7, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 7
NCBI Official Symbol
MAPK7
NCBI Official Synonym Symbols
BMK1; ERK4; ERK5; PRKM7
NCBI Protein Information
mitogen-activated protein kinase 7
UniProt Protein Name
Mitogen-activated protein kinase 7
UniProt Gene Name
MAPK7
UniProt Synonym Gene Names
BMK1; ERK5; PRKM7; MAP kinase 7; MAPK 7; BMK-1; ERK-5
UniProt Entry Name
MK07_HUMAN

NCBI Description

The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

ERK5: a protein kinase of the MAPK family. Phosphorylated and activated by MEK5. Involved in the signaling processes downstream of various receptors including receptor tyrosine kinases and G protein-coupled receptors. Translocates to cell nucleus in response to extracelluar signals, where it regulates gene expression by phosphorylating various transcription factors. Mouse knockout shows a role in development and integrity of blood vessels. May block apoptosis in endothelial cells. Required for transduction of EGF growth signal, constitutively activated in ErbB2-overexpressing breast cancer, and downstream of activated Mek5 in metastatic prostate cancerFour alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported.

Protein type: Kinase, protein; Protein kinase, CMGC; EC 2.7.11.24; Protein kinase, Ser/Thr (non-receptor); CMGC group; MAPK family; ERK subfamily; MAPK/ERK subfamily

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; PML body

Molecular Function: mitogen-activated protein kinase binding; protein binding; protein serine/threonine kinase activity

Biological Process: negative regulation of heterotypic cell-cell adhesion; negative regulation of inflammatory response; positive regulation of protein metabolic process; positive regulation of transcription from RNA polymerase II promoter; signal transduction

Research Articles on MAPK7

Similar Products

Product Notes

The MAPK7 mapk7 (Catalog #AAA1276563) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaagcg acctgcacca gatcatccac tcctcacagc ccctcacact ggaacacgtg cgctacttcc tgtaccaact gctgcggggc ctgaagtaca tgcactcggc tcaggtcatc caccgtgacc tgaagccctc caacctattg gtgaatgaga actgtgagct caagattggt gactttggta tggctcgtgg cctgtgcacc tcgcccgctg aacatcagta cttcatgact gagtatgtgg ccacgcgctg gtaccgtgcg cccgagctca tgctctcttt gcatgagtat acacaggcta ttgacctctg gtctgtgggc tgcatctttg gtgagatgct ggcccggcgc cagctcttcc caggcaaaaa ctatgtacac cagctacagc tcatcatgat ggtgctgggt accccatcac cagccgtgat tcaggctgtg ggggctgaga gggtgcgggc ctatatccag agcttgccac cacgccagcc tgtgccctgg gagacagtgt acccaggtgc cgaccgccag gccctatcac tgctgggtcg catgctgcgt tttgagccca gcgctcgcat ctcagcagct gctgcccttc gccacccttt cctggccaag taccatgatc ctgatgatga gcctgactgt gccccgccct ttgactttgc ctttgaccgc gaagccctca ctcgggagcg cattaaggag gccattgtgg ctgaaattga ggacttccat gcaaggcgtg agggcatccg ccaacagatc cgcttccagc cttctctaca gcctgtggct agtgagcctg gctgtccaga tgttgaaatg cccagtccct gggctcccag tggggactgt gccatggagt ctccaccacc agccccgcca ccatgccccg gccctgcacc tgacaccatt gatctgaccc tgcagccacc tccaccagtc agtgagcctg ccccaccaaa gaaagatggt gccatctcag acaatactaa ggctgccctt aaagctgccc tgctcaagtc tttgaggagc cggctcagag atggccccag cgcacccctg gaggctcctg agcctcggaa gccggtgaca gcccaggagc gccagcggga gcgggaggag aagcggcgga ggcggcaaga acgagccaag gagcgggaga aacggcggca ggagcgggag cgaaaggaac ggggggctgg ggcctctggg ggcccctcca ctgacccctt ggctggacta gtgctcagtg acaatgacag aagcctgttg gaacgctgga ctcgaatggc ccggcccgca gccccagccc tcacctctgt gccggcccct gccccagcgc caacgccaac cccaacccca gtccaaccta ccagtcctcc tcctggccct gtagcccagc ccactggccc gcaaccacaa tctgcgggct ctacctctgg ccctgtaccc cagcctgcct gcccaccccc tggccctgca ccccacccca ctggccctcc tgggcccatc cctgtccccg cgccacccca gattgccacc tccaccagcc tcctggctgc ccagtcactt gtgccacccc ctgggctgcc tggctccagc accccaggag ttttgcctta cttcccacct ggcctgccgc ccccagacgc cgggggagcc cctcagtctt ccatgtcaga gtcacctgat gtcaaccttg tgacccagca gctatctaag tcacaggtgg aggaccccct gccccctgtg ttctcaggca caccaaaggg cagtggggct ggctacggtg ttggctttga cctggaggaa ttcttaaacc agtctttcga catgggcgtg gctgatgggc cacaggatgg ccaggcagat tcagcctctc tctcagcctc cctgcttgct gactggctcg aaggccatgg catgaaccct gccgatattg agtccctgca gcgtgagatc cagatggact ccccaatgct gctggctgac ctgcctgacc tccaggaccc ctga. It is sometimes possible for the material contained within the vial of "MAPK7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.