Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPK14 cdna clone

MAPK14 cDNA Clone

Gene Names
MAPK14; RK; p38; CSBP; EXIP; Mxi2; CSBP1; CSBP2; CSPB1; PRKM14; PRKM15; SAPK2A; p38ALPHA
Synonyms
MAPK14; MAPK14 cDNA Clone; MAPK14 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcaggagaggcccacgttctaccggcaggagctgaacaagacaatctgggaggtgcccgagcgttaccagaacctgtctccagtgggctctggcgcctatggctctgtgtgtgctgcttttgacacaaaaacggggttacgtgtggcagtgaagaagctctccagaccatttcagtccatcattcatgcgaaaagaacctacagagaactgcggttacttaaacatatgaaacatgaaaatgtgattggtctgttggacgtttttacacctgcaaggtctctggaggaattcaatgatgtgtatctggtgacccatctcatgggggcagatctgaacaacattgtgaaatgtcagaagcttacagatgaccatgttcagttccttatctaccaaattctccgaggtctaaagtatatacattcagctgacataattcacagggacctaaaacctagtaatctagctgtgaatgaagactgtgagctgaagattctggattttggactggctcggcacacagatgatgaaatgacaggctacgtggccactaggtggtacagggctcctgagatcatgctgaactggatgcattacaaccagacagttgatatttggtcagtgggatgcataatggccgagctgttgactggaagaacattgtttcctggtacagaccatattgatcagttgaagctcattttaagactcgttggaaccccaggggctgagcttttgaagaaaatctcctcagagtctgcaagaaactatattcagtctttgactcagatgccgaagatgaactttgcgaatgtatttattggtgccaatcccctggctgtcgacttgctggagaagatgcttgtattggactcagataagagaattacagcggcccaagcccttgcacatgcctactttgctcagtaccacgatcctgatgatgaaccagtggccgatccttatgatcagtcctttgaaagcagggacctccttatagatgagtggaaaagcctgacctatgatgaagtcatcagctttgtgccaccaccccttgaccaagaagagatggagtcctga
Sequence Length
1083
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,388 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 14, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 14
NCBI Official Symbol
MAPK14
NCBI Official Synonym Symbols
RK; p38; CSBP; EXIP; Mxi2; CSBP1; CSBP2; CSPB1; PRKM14; PRKM15; SAPK2A; p38ALPHA
NCBI Protein Information
mitogen-activated protein kinase 14
UniProt Protein Name
Mitogen-activated protein kinase 14
UniProt Gene Name
MAPK14
UniProt Synonym Gene Names
CSBP; CSBP1; CSBP2; CSPB1; MXI2; SAPK2A; MAP kinase 14; MAPK 14; CSAID-binding protein; CSBP; MAP kinase p38 alpha; SAPK2a
UniProt Entry Name
MK14_HUMAN

NCBI Description

The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with this kinase. The substrates of this kinase include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of this kinase in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. Four alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

P38A: a proline-directed ser/thr MAP kinase, and one of four p38 kinases that play important roles in cellular responses to inflammatory cytokines, DNA damage, oxidative stress, and some GPCRs, leading to direct activation of transcription factors and of other downstream kinases including MSK1, MSK2, eEF2K, MK2, and PRAK. MSK1 and -2 play important roles in the rapid induction of immediate-early genes in response to stress or mitogenic stimuli. MK2 and -3 control gene expression mostly at the post-transcriptional level. eEF2K is important for the elongation of mRNA during translation. Ectodomain shedding of transmembrane proteins is regulated by p38 MAPKs as well. In response to inflammatory stimuli, p38 MAPKs phosphorylate the membrane-associated metalloprotease ADAM17, which then cleaves the ectodomain of TGF-alpha family ligands, a process leading to the activation of EGFR signaling and cell proliferation. In the nucleus, many transcription factors are phosphorylated and activated by p38 MAPKs in response to different stimuli. Classical examples include ATF1, ATF2, ATF6, ELK1, PTPRH, CHOPO, p53 and MEF2C and MEF2A. The p38 MAPKs are emerging as important modulators of gene expression by regulating chromatin modifiers and remodelers. The promoters of several genes involved in the inflammatory response, such as IL6, IL8 and IL12B, display a p38 MAPK-dependent enrichment of histone H3 phosphorylation on 'Ser-10' (H3S10ph) in LPS-stimulated myeloid cells. Interacts directly with HDAC3 interacts directly and selectively to repress ATF2 transcriptional activity, and regulate TNF gene expression in LPS-stimulated cells. Phosphorylates the ubiquitin ligase SIAH2, regulating its activity towards EGLN3. May also inhibit the lysosomal degradation pathway of autophagy by interfering with the intracellular trafficking of the transmembrane protein ATG9. Regulates the endocytosis of membrane receptors that depend on RAB5A. Regulates the clathrin-mediated internalization of EGFR induced by inflammatory cytokines and UV irradiation by phosphorylating the EGFR and RAB5A effectors. Required in mid-fetal development for the growth of embryo-derived blood vessels in the labyrinth layer of the placenta. Plays an essential role in developmental and stress-induced erythropoiesis, through regulation of EPO gene expression. Interacts with casein kinase II subunits CSNK2A1 and CSNK2B. Activated by cell stresses such as DNA damage, heat shock, osmotic shock, anisomycin and sodium arsenite, as well as pro-inflammatory stimuli such as LPS and IL-1. Phosphorylated by ZAP70 in an alternative activation pathway in response to TCR signaling in T-cells, a pathway is inhibited by GADD45A. Four alternatively spliced isoforms of the human protein have been observed. Isoform MXI2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2. Isoform EXIP may play a role in the early onset of apoptosis

Protein type: CMGC group; EC 2.7.11.24; Kinase, protein; MAPK family; MAPK/p38 subfamily; Protein kinase, CMGC; Protein kinase, Ser/Thr (non-receptor); p38 subfamily

Chromosomal Location of Human Ortholog: 6p21.3-p21.2

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: enzyme binding; MAP kinase activity; MAP kinase kinase activity; NFAT protein binding; protein binding; protein phosphatase binding; protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; cell motility; cell surface receptor linked signal transduction; chemotaxis; DNA damage response, signal transduction; osteoclast differentiation; peptidyl-serine phosphorylation; positive regulation of blood vessel endothelial cell migration; positive regulation of cyclase activity; positive regulation of erythrocyte differentiation; positive regulation of muscle cell differentiation; positive regulation of myoblast differentiation; Ras protein signal transduction; regulation of transcription factor activity; regulation of transcription from RNA polymerase II promoter; signal transduction; vascular endothelial growth factor receptor signaling pathway

Research Articles on MAPK14

Similar Products

Product Notes

The MAPK14 mapk14 (Catalog #AAA1278778) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcagg agaggcccac gttctaccgg caggagctga acaagacaat ctgggaggtg cccgagcgtt accagaacct gtctccagtg ggctctggcg cctatggctc tgtgtgtgct gcttttgaca caaaaacggg gttacgtgtg gcagtgaaga agctctccag accatttcag tccatcattc atgcgaaaag aacctacaga gaactgcggt tacttaaaca tatgaaacat gaaaatgtga ttggtctgtt ggacgttttt acacctgcaa ggtctctgga ggaattcaat gatgtgtatc tggtgaccca tctcatgggg gcagatctga acaacattgt gaaatgtcag aagcttacag atgaccatgt tcagttcctt atctaccaaa ttctccgagg tctaaagtat atacattcag ctgacataat tcacagggac ctaaaaccta gtaatctagc tgtgaatgaa gactgtgagc tgaagattct ggattttgga ctggctcggc acacagatga tgaaatgaca ggctacgtgg ccactaggtg gtacagggct cctgagatca tgctgaactg gatgcattac aaccagacag ttgatatttg gtcagtggga tgcataatgg ccgagctgtt gactggaaga acattgtttc ctggtacaga ccatattgat cagttgaagc tcattttaag actcgttgga accccagggg ctgagctttt gaagaaaatc tcctcagagt ctgcaagaaa ctatattcag tctttgactc agatgccgaa gatgaacttt gcgaatgtat ttattggtgc caatcccctg gctgtcgact tgctggagaa gatgcttgta ttggactcag ataagagaat tacagcggcc caagcccttg cacatgccta ctttgctcag taccacgatc ctgatgatga accagtggcc gatccttatg atcagtcctt tgaaagcagg gacctcctta tagatgagtg gaaaagcctg acctatgatg aagtcatcag ctttgtgcca ccaccccttg accaagaaga gatggagtcc tga. It is sometimes possible for the material contained within the vial of "MAPK14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.