Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP4K5 cdna clone

MAP4K5 cDNA Clone

Gene Names
MAP4K5; KHS; GCKR; KHS1; MAPKKKK5
Synonyms
MAP4K5; MAP4K5 cDNA Clone; MAP4K5 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccccgctgcggcctgccgcggacatcctgaggcggaacccgcagcaggactacgaactcgtccagagggtcggcagcggcacctacggggacgtctataaggccagaaatgtacacacaggagagctggctgcagtaaaaatcattaaattggagcctggagatgatttttctttgattcaacaagaaatatttatggttaaagaatgtaaacattgtaacatcgttgcctactttgggagttatcttagtcgggaaaaactatggatttgtatggaatactgtggtggcggatcacttcaagatatttaccatgttactggaccattatcagaattgcaaatagcctatgtatgcagagaaaccttacagggtcttgcctatttgcatactaaaggcaaaatgcatagagatatcaaaggtgctaatattttattgacagaccatggcgatgtaaaattagctgactttggtgtggctgcaaaaataacagctaccattgcaaaacgaaaatctttcattggcaccccttactggatggccccagaagttgcagcagtagagaagaatggtggctacaaccaactctgtgatatctgggcagtaggaataacagcaattgaacttggagaacttcagccacctatgtttgatctccacccaatgagggctctcttcttaatgtcaaaaagtaattttcagcctccaaaactaaaggacaaaacaaaatggtcatcaacattccataattttgtcaaaatagcactaaccaaaaacccaaaaaaaagaccaactgctgaaagacttctgactcacacttttgttgcacagccaggtctctctagagccctagcagttgaactgttagacaaagtgaacaatccagataaccacgcacattacactgaagcagatgacgatgactttgagccccatgcaatcattcgtcataccattagatctacaaacaggaatgccagagctgaacggacagcttcagaaataaattttgacaaattacaatttgaacctcctctgagaaaagaaacagaagcacgagatgaaatgggattgtcatcagacccaaatttcatgttacagtggaatccttttgttgatggtgcaaatactggcaaatcaacctcaaaacgtgcaataccacctcccctacctcctaagccaaggataagcagttaccctgaagacaactttccggatgaagaaaaagcatcaaccataaaacattgtcctgattcagaaagcagagctccccaaattctcagaagacagagtagcccaagttgtgggcctgtggcagagacttcttctattggaaatggtgatggtatttcaaaactgatgagtgaaaatacagaaggatcagcacaagcaccacagttaccacgaaaaaaggacaaacgagacttccctaaaccagccatcaatggccttccacccaccccaaaagttctgatgggagcatgcttttcaaaagtttttgatggctgtcctttgaaaattaattgtgcaacatcctggatacatcctgatacaaaagatcagtacattatttttggaactgaagatggtatttacacactgaatctcaatgagctacatgaggcaacgatggaacagttatttccacggaagtgtacttggctgtatgttatcaataatactttaatgtcattatcagaaggaaaaacctttcagctctactctcacaatcttatagctttgtttgaacatgccaaaaaaccaggattagctgcccatattcaaactcacaggtttccagaccgaatactaccaagaaaattcgctttaacaacaaagattcctgatacaaaaggctgccacaaatgttgcatagtcagaaacccttacacgggacataaatacctctgtggagctttacagtctggaattgttttacttcagtggtatgagccaatgcagaaattcatgttgataaagcactttgattttcctttgccaagtcctttgaatgtttttgaaatgctggtgatacctgaacaggaataccctatggtctgtgtagctattagcaaaggcactgaatcgaatcaggtagttcagtttgagacaatcaatttgaactctgcatcttcatggtttacagaaattggtgcaggcagccagcagttagattccattcatgtaacacagttggagagagataccgttttagtgtgtttagacaaatttgtgaaaattgtaaatctacaaggaaaattaaaatcaagtaagaaactggcctctgagttaagttttgattttcgcattgaatctgtagtatgccttcaagacagtgtgttggctttctggaaacatgggatgcagggtaaaagcttcaagtcagatgaggttacccaggagatttcagatgaaacaagagttttccgcttattaggatcagacagggttgtcgttttggaaagtaggccaacagaaaatcctactgcacacagcaatctctacatcttggctggacatgaaaatagttactaa
Sequence Length
2541
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
95,040 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase kinase kinase 5, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase kinase kinase 5
NCBI Official Symbol
MAP4K5
NCBI Official Synonym Symbols
KHS; GCKR; KHS1; MAPKKKK5
NCBI Protein Information
mitogen-activated protein kinase kinase kinase kinase 5
UniProt Protein Name
Mitogen-activated protein kinase kinase kinase kinase 5
UniProt Gene Name
MAP4K5
UniProt Synonym Gene Names
KHS; MEK kinase kinase 5; MEKKK 5
UniProt Entry Name
M4K5_HUMAN

NCBI Description

This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

KHS1: a serine/threonine protein kinase of the STE20 family. Highly similar to yeast SPS1/STE20 kinase. Activates Jun kinase in mammalian cells, which suggested a role in stress response.

Protein type: Protein kinase, STE; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; STE group; STE20 family; KHS subfamily

Chromosomal Location of Human Ortholog: 14q11.2-q21

Cellular Component: cytoplasm

Molecular Function: ATP binding; protein binding; protein kinase activity; protein serine/threonine kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of JNK activity; protein amino acid phosphorylation

Research Articles on MAP4K5

Similar Products

Product Notes

The MAP4K5 map4k5 (Catalog #AAA1275748) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccc cgctgcggcc tgccgcggac atcctgaggc ggaacccgca gcaggactac gaactcgtcc agagggtcgg cagcggcacc tacggggacg tctataaggc cagaaatgta cacacaggag agctggctgc agtaaaaatc attaaattgg agcctggaga tgatttttct ttgattcaac aagaaatatt tatggttaaa gaatgtaaac attgtaacat cgttgcctac tttgggagtt atcttagtcg ggaaaaacta tggatttgta tggaatactg tggtggcgga tcacttcaag atatttacca tgttactgga ccattatcag aattgcaaat agcctatgta tgcagagaaa ccttacaggg tcttgcctat ttgcatacta aaggcaaaat gcatagagat atcaaaggtg ctaatatttt attgacagac catggcgatg taaaattagc tgactttggt gtggctgcaa aaataacagc taccattgca aaacgaaaat ctttcattgg caccccttac tggatggccc cagaagttgc agcagtagag aagaatggtg gctacaacca actctgtgat atctgggcag taggaataac agcaattgaa cttggagaac ttcagccacc tatgtttgat ctccacccaa tgagggctct cttcttaatg tcaaaaagta attttcagcc tccaaaacta aaggacaaaa caaaatggtc atcaacattc cataattttg tcaaaatagc actaaccaaa aacccaaaaa aaagaccaac tgctgaaaga cttctgactc acacttttgt tgcacagcca ggtctctcta gagccctagc agttgaactg ttagacaaag tgaacaatcc agataaccac gcacattaca ctgaagcaga tgacgatgac tttgagcccc atgcaatcat tcgtcatacc attagatcta caaacaggaa tgccagagct gaacggacag cttcagaaat aaattttgac aaattacaat ttgaacctcc tctgagaaaa gaaacagaag cacgagatga aatgggattg tcatcagacc caaatttcat gttacagtgg aatccttttg ttgatggtgc aaatactggc aaatcaacct caaaacgtgc aataccacct cccctacctc ctaagccaag gataagcagt taccctgaag acaactttcc ggatgaagaa aaagcatcaa ccataaaaca ttgtcctgat tcagaaagca gagctcccca aattctcaga agacagagta gcccaagttg tgggcctgtg gcagagactt cttctattgg aaatggtgat ggtatttcaa aactgatgag tgaaaataca gaaggatcag cacaagcacc acagttacca cgaaaaaagg acaaacgaga cttccctaaa ccagccatca atggccttcc acccacccca aaagttctga tgggagcatg cttttcaaaa gtttttgatg gctgtccttt gaaaattaat tgtgcaacat cctggataca tcctgataca aaagatcagt acattatttt tggaactgaa gatggtattt acacactgaa tctcaatgag ctacatgagg caacgatgga acagttattt ccacggaagt gtacttggct gtatgttatc aataatactt taatgtcatt atcagaagga aaaacctttc agctctactc tcacaatctt atagctttgt ttgaacatgc caaaaaacca ggattagctg cccatattca aactcacagg tttccagacc gaatactacc aagaaaattc gctttaacaa caaagattcc tgatacaaaa ggctgccaca aatgttgcat agtcagaaac ccttacacgg gacataaata cctctgtgga gctttacagt ctggaattgt tttacttcag tggtatgagc caatgcagaa attcatgttg ataaagcact ttgattttcc tttgccaagt cctttgaatg tttttgaaat gctggtgata cctgaacagg aataccctat ggtctgtgta gctattagca aaggcactga atcgaatcag gtagttcagt ttgagacaat caatttgaac tctgcatctt catggtttac agaaattggt gcaggcagcc agcagttaga ttccattcat gtaacacagt tggagagaga taccgtttta gtgtgtttag acaaatttgt gaaaattgta aatctacaag gaaaattaaa atcaagtaag aaactggcct ctgagttaag ttttgatttt cgcattgaat ctgtagtatg ccttcaagac agtgtgttgg ctttctggaa acatgggatg cagggtaaaa gcttcaagtc agatgaggtt acccaggaga tttcagatga aacaagagtt ttccgcttat taggatcaga cagggttgtc gttttggaaa gtaggccaac agaaaatcct actgcacaca gcaatctcta catcttggct ggacatgaaa atagttacta a. It is sometimes possible for the material contained within the vial of "MAP4K5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.