Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP2K5 cdna clone

MAP2K5 cDNA Clone

Gene Names
MAP2K5; MEK5; MAPKK5; PRKMK5; HsT17454
Synonyms
MAP2K5; MAP2K5 cDNA Clone; MAP2K5 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgtggctagcccttggcccctttcctgccatggagaaccaggtgctggtaattcgcatcaagatcccaaatagtggcgcggtggactggacagtgcactccgggccgcagttactcttcagggatgtgctggatgtgataggccaggttctgcctgaagcaacaactacagcatttgaatatgaagatgaagatggtgatcgaattacagtgagaagtgatgaggaaatgaaggcaatgctgtcatattattattccacagtaatggaacagcaagtaaatggacagttaatagagcctctgcagatatttccaagagcctgcaagcctcctggggaacggaacatacatggcctgaaggtgaatactcgggccggaccctctcaacacagcagcccagcagtctcagattcacttccaagcaatagcttaaagaagtcttctgctgaactgaaaaaaatactagccaatggccagatgaatgaacaagacatacgatatcgggacactcttggtcatggcaacggaggcacagtctacaaagcatatcatgtcccgagtgggaaaatattagctgtaaaggtcatactactagatattacactggaacttcagaagcaaattatgtctgaattggaaattctttataagtgcgattcatcatatatcattggattttatggagcattttttgtagaaaacaggatttcaatatgtacagaattcatggatgggggatctttggatgtatataggaaaatgccagaacatgtccttggaagaattgcagtagcagttgttaaaggccttacttatttgtggagtttaaagattttacatagagacgtgaagccctccaatatgctagtaaacacaagaggacaggttaagctgtgtgattttggagttagcactcagctggtgaattctatagccaagacgtatgttggaacaaatgcttatatggcgcctgaaaggatttcaggggagcagtatggaattcattctgatgtctggagcttaggaatctcttttatggagcttgctcttgggaggtttccatatcctcagattcagaaaaaccagggatctttaatgcctctccagcttctgcagtgcattgttgatgaggattcgcccgtccttccagttggagagttctcggagccatttgtacatttcatcactcagtgtatgcgaaaacagccaaaagaaaggccagcacctgaagaattgatgggccacccgttcatcgtgcagttcaatgatggaaatgccgccgtggtgtccatgtgggtgtgccgggcgctggaggagaggcggagccagcaggggcccccgtga
Sequence Length
1347
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,131 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase 5, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase 5
NCBI Official Symbol
MAP2K5
NCBI Official Synonym Symbols
MEK5; MAPKK5; PRKMK5; HsT17454
NCBI Protein Information
dual specificity mitogen-activated protein kinase kinase 5
UniProt Protein Name
Dual specificity mitogen-activated protein kinase kinase 5
UniProt Gene Name
MAP2K5
UniProt Synonym Gene Names
MEK5; MKK5; PRKMK5; MAP kinase kinase 5; MAPKK 5; MEK 5
UniProt Entry Name
MP2K5_HUMAN

NCBI Description

The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]

Uniprot Description

MEK5: a dual specificity protein kinase of the STE7 family. Activates ERK5 and is itself phosphorylated and activated by MEKK3, as well as by atypical protein kinase C isoforms. Involved in growth factor stimulated cell proliferation and muscle cell differentiation. Four alternatively spliced isoforms have been described.

Protein type: Kinase, protein; Protein kinase, STE; EC 2.7.12.2; Protein kinase, dual-specificity (non-receptor); STE group; STE7 family

Chromosomal Location of Human Ortholog: 15q23

Cellular Component: cytoplasm

Molecular Function: protein binding; protein kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; inhibition of NF-kappaB transcription factor; negative regulation of caspase activity; negative regulation of heterotypic cell-cell adhesion; negative regulation of interleukin-8 biosynthetic process; negative regulation of transcription from RNA polymerase II promoter; positive regulation of protein metabolic process; positive regulation of transcription from RNA polymerase II promoter; signal transduction

Research Articles on MAP2K5

Similar Products

Product Notes

The MAP2K5 map2k5 (Catalog #AAA1277937) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtggc tagcccttgg cccctttcct gccatggaga accaggtgct ggtaattcgc atcaagatcc caaatagtgg cgcggtggac tggacagtgc actccgggcc gcagttactc ttcagggatg tgctggatgt gataggccag gttctgcctg aagcaacaac tacagcattt gaatatgaag atgaagatgg tgatcgaatt acagtgagaa gtgatgagga aatgaaggca atgctgtcat attattattc cacagtaatg gaacagcaag taaatggaca gttaatagag cctctgcaga tatttccaag agcctgcaag cctcctgggg aacggaacat acatggcctg aaggtgaata ctcgggccgg accctctcaa cacagcagcc cagcagtctc agattcactt ccaagcaata gcttaaagaa gtcttctgct gaactgaaaa aaatactagc caatggccag atgaatgaac aagacatacg atatcgggac actcttggtc atggcaacgg aggcacagtc tacaaagcat atcatgtccc gagtgggaaa atattagctg taaaggtcat actactagat attacactgg aacttcagaa gcaaattatg tctgaattgg aaattcttta taagtgcgat tcatcatata tcattggatt ttatggagca ttttttgtag aaaacaggat ttcaatatgt acagaattca tggatggggg atctttggat gtatatagga aaatgccaga acatgtcctt ggaagaattg cagtagcagt tgttaaaggc cttacttatt tgtggagttt aaagatttta catagagacg tgaagccctc caatatgcta gtaaacacaa gaggacaggt taagctgtgt gattttggag ttagcactca gctggtgaat tctatagcca agacgtatgt tggaacaaat gcttatatgg cgcctgaaag gatttcaggg gagcagtatg gaattcattc tgatgtctgg agcttaggaa tctcttttat ggagcttgct cttgggaggt ttccatatcc tcagattcag aaaaaccagg gatctttaat gcctctccag cttctgcagt gcattgttga tgaggattcg cccgtccttc cagttggaga gttctcggag ccatttgtac atttcatcac tcagtgtatg cgaaaacagc caaaagaaag gccagcacct gaagaattga tgggccaccc gttcatcgtg cagttcaatg atggaaatgc cgccgtggtg tccatgtggg tgtgccgggc gctggaggag aggcggagcc agcaggggcc cccgtga. It is sometimes possible for the material contained within the vial of "MAP2K5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.