Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAN1B1 cdna clone

MAN1B1 cDNA Clone

Gene Names
MAN1B1; MRT15; ERMAN1; ERManI; MANA-ER
Synonyms
MAN1B1; MAN1B1 cDNA Clone; MAN1B1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcctgcgagggcaggagaagcggagctctcggttcctctcagtcggacttcctgacgccgccagtgggcggggccccttgggccgtcgccaccactgtagtcatgtacccaccgccgccgccgccgcctcatcgggacttcatctcggtgacgctgagctttggcgagagctatgacaacagcaagagttggcggcggcgctcgtgctggaggaaatggaagcaactgtcgagattgcagcggaatatgattctcttcctccttgcctttctgcttttctgtggactcctcttctacatcaacttggctgaccattggaaagctctggctttcaggctagaggaagagcagaagatgaggccagaaattgctgggttaaaaccagcaaatccacccgtcttaccagctcctcagaaggcggacaccgaccctgagaacttacctgagatttcgtcacagaagacacaaagacacatccagcggggaccacctcacctgcagattagacccccaagccaagacctgaaggatgggacccaggaggaggccacaaaaaggcaagaagcccctgtggatccccgcccggaaggagatccgcagaggacagtcatcagctggaggggagcggtgatcgagcctgagcagggcaccgagctcccttcaagaagagcagaagtgcccaccaagcctcccctgccaccggccaggacacagggcacaccagtgcatctgaactatcgccagaagggcgtgattgacgtcttcctgcatgcatggaaaggataccgcaagtttgcatggggccatgacgagctgaagcctgtgtccaggtccttcagtgagtggtttggcctcggtctcacactgatcgacgcgctggacaccatgtggatcttgggtctgaggaaagaatttgaggaagccaggaagtgggtgtcgaagaagttacactttgaaaaggacgtggacgtcaacctgtttgagagcacgatccgcatcctgggggggctcctgagtgcctaccacctgtctggggacagcctcttcctgaggaaagctgaggattttggaaatcggctaatgcctgccttcagaacaccatccaagattccttactcggatgtgaacatcggtactggagttgcccacccgccacggtggacctccgacagcactgtggccgaggtgaccagcattcagctggagttccgggagctctcccgtctcacaggggataagaagtttcaggaggcagtggagaaggtgacacagcacatccacggcctgtctgggaagaaggatgggctggtgcccatgttcatcaatacccacagtggcctcttcacccacctgggcgtattcacgctgggcgccagggccgacagctactatgagtacctgctgaagcagtggatccagggcgggaagcaggagacacagctgctggaagactacgtggaagccatcgagggtgtcagaacgcacctgctgcggcactccgagcccagtaagctcacctttgtgggggagcttgcccacggccgcttcagtgccaagatggaccacctggtgtgcttcctgccagggacgctggctctgggcgtctaccacggcctgcccgccagccacatggagctggcccaggagctcatggagacttgttaccagatgaaccggcagatggagacggggctgagtcccgagatcgtgcacttcaacctttacccccagccgggccgtcgggacgtggaggtcaagccagcagacaggcacaacctgctgcggccagagaccgtggagagcctgttctacctgtaccgcgtcacaggggaccgcaaataccaggactggggctgggagattctgcagagcttcagccgattcacacgggtcccctcgggtggctattcttccatcaacaatgtccaggatcctcagaagcccgagcctagggacaagatggagagcttcttcctgggggagacgctcaagtatctgttcttgctcttctccgatgacccaaacctgctcagcctggatgcctacgtgttcaacaccgaagcccaccctctgcctatctggacccctgcctag
Sequence Length
2100
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,580 Da
NCBI Official Full Name
Homo sapiens mannosidase, alpha, class 1B, member 1, mRNA
NCBI Official Synonym Full Names
mannosidase alpha class 1B member 1
NCBI Official Symbol
MAN1B1
NCBI Official Synonym Symbols
MRT15; ERMAN1; ERManI; MANA-ER
NCBI Protein Information
endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase
UniProt Protein Name
Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase
UniProt Gene Name
MAN1B1
UniProt Synonym Gene Names
ERMan1
UniProt Entry Name
MA1B1_HUMAN

NCBI Description

This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Dec 2011]

Uniprot Description

MAN1B1: Involved in glycoprotein quality control targeting of misfolded glycoproteins for degradation. It primarily trims a single alpha-1,2-linked mannose residue from Man(9)GlcNAc(2) to produce Man(8)GlcNAc(2), but at high enzyme concentrations, as found in the ER quality control compartment (ERQC), it further trims the carbohydrates to Man(5-6)GlcNAc(2). Defects in MAN1B1 are the cause of mental retardation autosomal recessive type 15 (MRT15). Mental retardation is characterized by significantly below average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Belongs to the glycosyl hydrolase 47 family.

Protein type: Calcium-binding; EC 3.2.1.113; Endoplasmic reticulum; Glycan Metabolism - N-glycan biosynthesis; Hydrolase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: endoplasmic reticulum; Golgi apparatus; integral to membrane; membrane

Molecular Function: alpha-mannosidase activity; calcium ion binding; mannosyl-oligosaccharide 1,2-alpha-mannosidase activity

Biological Process: ER-associated protein catabolic process; N-glycan processing; oligosaccharide metabolic process

Disease: Mental Retardation, Autosomal Recessive 15

Research Articles on MAN1B1

Similar Products

Product Notes

The MAN1B1 man1b1 (Catalog #AAA1278083) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcct gcgagggcag gagaagcgga gctctcggtt cctctcagtc ggacttcctg acgccgccag tgggcggggc cccttgggcc gtcgccacca ctgtagtcat gtacccaccg ccgccgccgc cgcctcatcg ggacttcatc tcggtgacgc tgagctttgg cgagagctat gacaacagca agagttggcg gcggcgctcg tgctggagga aatggaagca actgtcgaga ttgcagcgga atatgattct cttcctcctt gcctttctgc ttttctgtgg actcctcttc tacatcaact tggctgacca ttggaaagct ctggctttca ggctagagga agagcagaag atgaggccag aaattgctgg gttaaaacca gcaaatccac ccgtcttacc agctcctcag aaggcggaca ccgaccctga gaacttacct gagatttcgt cacagaagac acaaagacac atccagcggg gaccacctca cctgcagatt agacccccaa gccaagacct gaaggatggg acccaggagg aggccacaaa aaggcaagaa gcccctgtgg atccccgccc ggaaggagat ccgcagagga cagtcatcag ctggagggga gcggtgatcg agcctgagca gggcaccgag ctcccttcaa gaagagcaga agtgcccacc aagcctcccc tgccaccggc caggacacag ggcacaccag tgcatctgaa ctatcgccag aagggcgtga ttgacgtctt cctgcatgca tggaaaggat accgcaagtt tgcatggggc catgacgagc tgaagcctgt gtccaggtcc ttcagtgagt ggtttggcct cggtctcaca ctgatcgacg cgctggacac catgtggatc ttgggtctga ggaaagaatt tgaggaagcc aggaagtggg tgtcgaagaa gttacacttt gaaaaggacg tggacgtcaa cctgtttgag agcacgatcc gcatcctggg ggggctcctg agtgcctacc acctgtctgg ggacagcctc ttcctgagga aagctgagga ttttggaaat cggctaatgc ctgccttcag aacaccatcc aagattcctt actcggatgt gaacatcggt actggagttg cccacccgcc acggtggacc tccgacagca ctgtggccga ggtgaccagc attcagctgg agttccggga gctctcccgt ctcacagggg ataagaagtt tcaggaggca gtggagaagg tgacacagca catccacggc ctgtctggga agaaggatgg gctggtgccc atgttcatca atacccacag tggcctcttc acccacctgg gcgtattcac gctgggcgcc agggccgaca gctactatga gtacctgctg aagcagtgga tccagggcgg gaagcaggag acacagctgc tggaagacta cgtggaagcc atcgagggtg tcagaacgca cctgctgcgg cactccgagc ccagtaagct cacctttgtg ggggagcttg cccacggccg cttcagtgcc aagatggacc acctggtgtg cttcctgcca gggacgctgg ctctgggcgt ctaccacggc ctgcccgcca gccacatgga gctggcccag gagctcatgg agacttgtta ccagatgaac cggcagatgg agacggggct gagtcccgag atcgtgcact tcaaccttta cccccagccg ggccgtcggg acgtggaggt caagccagca gacaggcaca acctgctgcg gccagagacc gtggagagcc tgttctacct gtaccgcgtc acaggggacc gcaaatacca ggactggggc tgggagattc tgcagagctt cagccgattc acacgggtcc cctcgggtgg ctattcttcc atcaacaatg tccaggatcc tcagaagccc gagcctaggg acaagatgga gagcttcttc ctgggggaga cgctcaagta tctgttcttg ctcttctccg atgacccaaa cctgctcagc ctggatgcct acgtgttcaa caccgaagcc caccctctgc ctatctggac ccctgcctag. It is sometimes possible for the material contained within the vial of "MAN1B1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.