Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGOH cdna clone

MAGOH cDNA Clone

Gene Names
MAGOH; MAGOH1; MAGOHA
Synonyms
MAGOH; MAGOH cDNA Clone; MAGOH cdna clone
Ordering
For Research Use Only!
Sequence
atggagagtgacttttatctgcgttactacgtggggcacaagggcaagttcggccacgagttcctggagtttgagtttcgaccggacgggaagttaagatatgccaacaacagcaattacaagaatgatgtcatgatcagaaaagaggcttatgtacataaaagcgtgatggaggaactgaagagaataattgacgacagtgaaattaccaaagaggatgatgcattgtggcctcctcctgaccgagtgggccggcaggagcttgaaatcgtcattggagatgaacacatttcttttacaacatcaaaaattggttcccttattgatgtcaatcaatccaaggatccagaaggcttacgagtattttattatcttgtccaggacctgaagtgtttggtcttcagtcttattggattacacttcaagattaaaccaatctag
Sequence Length
441
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,844 Da
NCBI Official Full Name
Homo sapiens mago-nashi homolog, proliferation-associated (Drosophila), mRNA
NCBI Official Synonym Full Names
mago homolog, exon junction complex core component
NCBI Official Symbol
MAGOH
NCBI Official Synonym Symbols
MAGOH1; MAGOHA
NCBI Protein Information
protein mago nashi homolog
UniProt Protein Name
Protein mago nashi homolog
Protein Family
UniProt Gene Name
MAGOH
UniProt Synonym Gene Names
MAGOHA
UniProt Entry Name
MGN_HUMAN

NCBI Description

Drosophila that have mutations in their mago nashi (grandchildless) gene produce progeny with defects in germplasm assembly and germline development. This gene encodes the mammalian mago nashi homolog. In mammals, mRNA expression is not limited to the germ plasm, but is expressed ubiquitously in adult tissues and can be induced by serum stimulation of quiescent fibroblasts. [provided by RefSeq, Jul 2008]

Uniprot Description

MAGOH: Component of a splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junction on mRNAs. The EJC is a dynamic structure consisting of a few core proteins and several more peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. Core components of the EJC, that remains bound to spliced mRNAs throughout all stages of mRNA metabolism, functions to mark the position of the exon-exon junction in the mature mRNA and thereby influences downstream processes of gene expression including mRNA splicing, nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Remains associated with the mRNA after its export to the cytoplasm and require translation of the mRNA for removal. The heterodimer MAGOH-RBM8A interacts with PYM that function to enhance the translation of EJC-bearing spliced mRNAs by recruiting them to the ribosomal 48S preinitiation complex. Belongs to the mago nashi family.

Protein type: RNA splicing; Spliceosome

Chromosomal Location of Human Ortholog: 1p32.3

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: mRNA 3'-end processing; mRNA catabolic process, nonsense-mediated decay; mRNA export from nucleus; nuclear mRNA splicing, via spliceosome; regulation of alternative nuclear mRNA splicing, via spliceosome; RNA export from nucleus; termination of RNA polymerase II transcription

Research Articles on MAGOH

Similar Products

Product Notes

The MAGOH magoh (Catalog #AAA1271317) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagtg acttttatct gcgttactac gtggggcaca agggcaagtt cggccacgag ttcctggagt ttgagtttcg accggacggg aagttaagat atgccaacaa cagcaattac aagaatgatg tcatgatcag aaaagaggct tatgtacata aaagcgtgat ggaggaactg aagagaataa ttgacgacag tgaaattacc aaagaggatg atgcattgtg gcctcctcct gaccgagtgg gccggcagga gcttgaaatc gtcattggag atgaacacat ttcttttaca acatcaaaaa ttggttccct tattgatgtc aatcaatcca aggatccaga aggcttacga gtattttatt atcttgtcca ggacctgaag tgtttggtct tcagtcttat tggattacac ttcaagatta aaccaatcta g. It is sometimes possible for the material contained within the vial of "MAGOH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.