MAGEB4 cdna clone
MAGEB4 cDNA Clone
Gene Names
MAGEB4; CT3.6
Synonyms
MAGEB4; MAGEB4 cDNA Clone; MAGEB4 cdna clone
Sequence
atgcctcggggtcagaagagtaagctccgtgcccgtgagaaacgccagcggacccgtggtcagacccaggatctcaaggttggtcagcctactgcagcagagaaagaagagtctccttccccttcctcatctgttttgagggatactgcctccagctcccttgcttttggcattccccaggagcctcagagagagccacccaccacctctgctgctgcagctatgtcatgcactggatctgataaaggcgacgagagccaagatgaggaaaatgcaagttcctcccaggcctcaacatccactgagagatcactcaaagattctctaaccaggaagacgaagatgttagtgcagttcctgctgtacaagtataaaatgaaagagcccactacaaaggcagaaatgctgaagatcatcagcaaaaagtacaaggagcacttccctgagatcttcaggaaagtctctcagcgcacggagctggtctttggccttgccttgaaggaggtcaaccccaccactcactcctacatcctcgtcagcatgctaggccccaactatggaaaccagagcagtgcctggacccttccaaggaatgggcttctgatgcctctactgagtgtgatcttcttaaatggcaactgtgcccgtgaagaggaaatctgggaattcctgaatatgctggggatctatgatggaaagaggcaccttatctttggggaaccccgaaagctcatcacccaagatctggtgcaggaaaaatatctggaataccagcaggtgcccaacagtgatcccccacgctatcaattcctgtggggtccaagagctcatgcagaaaccagcaagatgaaagtcctggagtttttggccaaggtgaatgacaccacccccaataacttcccactcctttatgaagaggctttgagagatgaagaagagagagctggagcccggcccagagttgcagccaggcgtggcactacagccatgactagtgcgtattccagggccacatccagtagctcttcccaacccatgtga
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,923 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family B, 4, mRNA
NCBI Official Synonym Full Names
MAGE family member B4
NCBI Official Symbol
MAGEB4
NCBI Official Synonym Symbols
CT3.6
NCBI Protein Information
melanoma-associated antigen B4
UniProt Protein Name
Melanoma-associated antigen B4
Protein Family
UniProt Gene Name
MAGEB4
UniProt Entry Name
MAGB4_HUMAN
NCBI Description
This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEB genes are clustered on chromosome Xp22-p21. This gene sequence ends in the first intron of MAGEB1, another family member. This gene is expressed in testis. [provided by RefSeq, Jul 2008]
Uniprot Description
MAGE-B4:
Protein type: Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: Xp21.3
Molecular Function: protein binding
Similar Products
Product Notes
The MAGEB4 mageb4 (Catalog #AAA1268575) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcggg gtcagaagag taagctccgt gcccgtgaga aacgccagcg gacccgtggt cagacccagg atctcaaggt tggtcagcct actgcagcag agaaagaaga gtctccttcc ccttcctcat ctgttttgag ggatactgcc tccagctccc ttgcttttgg cattccccag gagcctcaga gagagccacc caccacctct gctgctgcag ctatgtcatg cactggatct gataaaggcg acgagagcca agatgaggaa aatgcaagtt cctcccaggc ctcaacatcc actgagagat cactcaaaga ttctctaacc aggaagacga agatgttagt gcagttcctg ctgtacaagt ataaaatgaa agagcccact acaaaggcag aaatgctgaa gatcatcagc aaaaagtaca aggagcactt ccctgagatc ttcaggaaag tctctcagcg cacggagctg gtctttggcc ttgccttgaa ggaggtcaac cccaccactc actcctacat cctcgtcagc atgctaggcc ccaactatgg aaaccagagc agtgcctgga cccttccaag gaatgggctt ctgatgcctc tactgagtgt gatcttctta aatggcaact gtgcccgtga agaggaaatc tgggaattcc tgaatatgct ggggatctat gatggaaaga ggcaccttat ctttggggaa ccccgaaagc tcatcaccca agatctggtg caggaaaaat atctggaata ccagcaggtg cccaacagtg atcccccacg ctatcaattc ctgtggggtc caagagctca tgcagaaacc agcaagatga aagtcctgga gtttttggcc aaggtgaatg acaccacccc caataacttc ccactccttt atgaagaggc tttgagagat gaagaagaga gagctggagc ccggcccaga gttgcagcca ggcgtggcac tacagccatg actagtgcgt attccagggc cacatccagt agctcttccc aacccatgtg a. It is sometimes possible for the material contained within the vial of "MAGEB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
