MAGEB3 cdna clone
MAGEB3 cDNA Clone
Gene Names
MAGEB3; CT3.5
Synonyms
MAGEB3; MAGEB3 cDNA Clone; MAGEB3 cdna clone
Sequence
atgcctcggggtcagaagagtacgctccatgcacgtgagaaacgccagcagacccggggtcagacccaggatcaccagggtgctcagatcactgcaactaacaagaaaaaagtatccttttcatcccctcttattttgggggctactatccagaaaaagtctgctggtaggtcacgtagtgctctcaagaagcctcagagagcactatccaccactacatctgtagatgtttcttacaaaaagtcatacaagggagccaacagcaaaattgagaaaaagcaaagcttctctcagggtctatcctccactgtgcagtctcgcacagaccctctaatcatgaagacaaatatgttggtgcagttcctgatggaaatgtacaagatgaaaaagcccattatgaaagcagatatgctaaaaattgtccaaaaaagccataagaattgcttccctgagatccttaaaaaagcttctttcaacatggaggtggtatttggtgttgatttaaagaaagttgattctaccaaggactcctatgtccttgtcagcaaaatggatctccccaacaatgggacagtgactcgtgggaggggatttcccaagacaggtctcctgctgaatctcctgggcgtgatcttcatgaagggcaactgtgccactgaggagaagatctgggaattcctgaataagatgagaatatatgatgggaagaaacacttcatatttggggagcccagaaagctcatcacccaagatttggtgaagcttaaatacctggagtaccgacaagtgcccaacagtaatcctgcacgctatgaattcctgtggggtccaagagcccatgctgaaaccagcaagatgaaggtcctggagttttgggccaaggtcaataaaactgtccccagtgcgttccagttctggtatgaagaggctttgagagatgaggaagaaagagtccaagctgcagctatgctcaatgatggcagtagtgccatgggcagaaagtgttccaaggccaaggctagcagctcttcccacgcctag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,211 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family B, 3, mRNA
NCBI Official Synonym Full Names
MAGE family member B3
NCBI Official Symbol
MAGEB3
NCBI Official Synonym Symbols
CT3.5
NCBI Protein Information
melanoma-associated antigen B3
UniProt Protein Name
Melanoma-associated antigen B3
Protein Family
UniProt Gene Name
MAGEB3
UniProt Entry Name
MAGB3_HUMAN
NCBI Description
This gene is a MAGE-B subfamily member of the MAGE gene family. MAGE family member proteins direct the expression of tumor antigens recognized on a human melanoma by autologous cytolytic T lymphocytes. There are two known clusters of MAGE genes on chromosome X. The members of the MAGE-A subfamily are located in the Xq28 region, while the members of the MAGE-B subfamily are clustered in the Xp21 region. [provided by RefSeq, Jul 2008]
Uniprot Description
MAGE-B3:
Protein type: Cancer Testis Antigen (CTA)
Chromosomal Location of Human Ortholog: Xp21.3
Similar Products
Product Notes
The MAGEB3 mageb3 (Catalog #AAA1278443) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcggg gtcagaagag tacgctccat gcacgtgaga aacgccagca gacccggggt cagacccagg atcaccaggg tgctcagatc actgcaacta acaagaaaaa agtatccttt tcatcccctc ttattttggg ggctactatc cagaaaaagt ctgctggtag gtcacgtagt gctctcaaga agcctcagag agcactatcc accactacat ctgtagatgt ttcttacaaa aagtcataca agggagccaa cagcaaaatt gagaaaaagc aaagcttctc tcagggtcta tcctccactg tgcagtctcg cacagaccct ctaatcatga agacaaatat gttggtgcag ttcctgatgg aaatgtacaa gatgaaaaag cccattatga aagcagatat gctaaaaatt gtccaaaaaa gccataagaa ttgcttccct gagatcctta aaaaagcttc tttcaacatg gaggtggtat ttggtgttga tttaaagaaa gttgattcta ccaaggactc ctatgtcctt gtcagcaaaa tggatctccc caacaatggg acagtgactc gtgggagggg atttcccaag acaggtctcc tgctgaatct cctgggcgtg atcttcatga agggcaactg tgccactgag gagaagatct gggaattcct gaataagatg agaatatatg atgggaagaa acacttcata tttggggagc ccagaaagct catcacccaa gatttggtga agcttaaata cctggagtac cgacaagtgc ccaacagtaa tcctgcacgc tatgaattcc tgtggggtcc aagagcccat gctgaaacca gcaagatgaa ggtcctggag ttttgggcca aggtcaataa aactgtcccc agtgcgttcc agttctggta tgaagaggct ttgagagatg aggaagaaag agtccaagct gcagctatgc tcaatgatgg cagtagtgcc atgggcagaa agtgttccaa ggccaaggct agcagctctt cccacgccta g. It is sometimes possible for the material contained within the vial of "MAGEB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
