Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEB3 cdna clone

MAGEB3 cDNA Clone

Gene Names
MAGEB3; CT3.5
Synonyms
MAGEB3; MAGEB3 cDNA Clone; MAGEB3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcggggtcagaagagtacgctccatgcacgtgagaaacgccagcagacccggggtcagacccaggatcaccagggtgctcagatcactgcaactaacaagaaaaaagtatccttttcatcccctcttattttgggggctactatccagaaaaagtctgctggtaggtcacgtagtgctctcaagaagcctcagagagcactatccaccactacatctgtagatgtttcttacaaaaagtcatacaagggagccaacagcaaaattgagaaaaagcaaagcttctctcagggtctatcctccactgtgcagtctcacacagaccctctaaccatgaagacaaatatgttggtgcagttcctgatggaaatgtacaagatgaaaaagcccattatgaaagcagatatgctaaaaattgtccaaaaaagccataagaattgcttccctgagatccttaaaaaagcttctttcaacatggaggtggtgtttggtgttgatttaaagaaagttgattctaccaaggactcctatgtccttgtcagcaaaatggatctccccaacaatgggacagtgactcgtgggaggggatttcccaagacaggtctcctgctgaatctcctgggcgtgatcttcatgaagggcaactgtgccactgaggagaagatctgggaattcctgaataagatgagaatatatgatgggaagaaacacttcatatttggggagcccagaaagctcatcacccaagatttggtgaagcttaaatacctggagtaccgacaagtgcccaacagtaatcctgcacgctatgaattcctgtggggtccaagagcccatgctgaaaccagcaagatgaaggtcctggagttttgggccaaggtcaataaaactgtccccagtgcgttccagttctggtatgaagaggctttgagagatgaggaagaaagagtccaagctgcagctatgctcaatgatggcagtagtgccatgggcagaaagtgttccaaggccaaggctagcagctcttcccacgcctag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,211 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family B, 3, mRNA
NCBI Official Synonym Full Names
MAGE family member B3
NCBI Official Symbol
MAGEB3
NCBI Official Synonym Symbols
CT3.5
NCBI Protein Information
melanoma-associated antigen B3
UniProt Protein Name
Melanoma-associated antigen B3
UniProt Gene Name
MAGEB3
UniProt Entry Name
MAGB3_HUMAN

NCBI Description

This gene is a MAGE-B subfamily member of the MAGE gene family. MAGE family member proteins direct the expression of tumor antigens recognized on a human melanoma by autologous cytolytic T lymphocytes. There are two known clusters of MAGE genes on chromosome X. The members of the MAGE-A subfamily are located in the Xq28 region, while the members of the MAGE-B subfamily are clustered in the Xp21 region. [provided by RefSeq, Jul 2008]

Uniprot Description

MAGE-B3:

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xp21.3

Similar Products

Product Notes

The MAGEB3 mageb3 (Catalog #AAA1274207) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcggg gtcagaagag tacgctccat gcacgtgaga aacgccagca gacccggggt cagacccagg atcaccaggg tgctcagatc actgcaacta acaagaaaaa agtatccttt tcatcccctc ttattttggg ggctactatc cagaaaaagt ctgctggtag gtcacgtagt gctctcaaga agcctcagag agcactatcc accactacat ctgtagatgt ttcttacaaa aagtcataca agggagccaa cagcaaaatt gagaaaaagc aaagcttctc tcagggtcta tcctccactg tgcagtctca cacagaccct ctaaccatga agacaaatat gttggtgcag ttcctgatgg aaatgtacaa gatgaaaaag cccattatga aagcagatat gctaaaaatt gtccaaaaaa gccataagaa ttgcttccct gagatcctta aaaaagcttc tttcaacatg gaggtggtgt ttggtgttga tttaaagaaa gttgattcta ccaaggactc ctatgtcctt gtcagcaaaa tggatctccc caacaatggg acagtgactc gtgggagggg atttcccaag acaggtctcc tgctgaatct cctgggcgtg atcttcatga agggcaactg tgccactgag gagaagatct gggaattcct gaataagatg agaatatatg atgggaagaa acacttcata tttggggagc ccagaaagct catcacccaa gatttggtga agcttaaata cctggagtac cgacaagtgc ccaacagtaa tcctgcacgc tatgaattcc tgtggggtcc aagagcccat gctgaaacca gcaagatgaa ggtcctggag ttttgggcca aggtcaataa aactgtcccc agtgcgttcc agttctggta tgaagaggct ttgagagatg aggaagaaag agtccaagct gcagctatgc tcaatgatgg cagtagtgcc atgggcagaa agtgttccaa ggccaaggct agcagctctt cccacgccta g. It is sometimes possible for the material contained within the vial of "MAGEB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.