Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEA10 cdna clone

MAGEA10 cDNA Clone

Gene Names
MAGEA10; CT1.10; MAGE10
Synonyms
MAGEA10; MAGEA10 cDNA Clone; MAGEA10 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcgagctccaaagcgtcagcgctgcatgcctgaagaagatcttcaatcccaaagtgagacacagggcctcgagggtgcacaggctcccctggctgtggaggaggatgcttcatcatccacttccaccagctcctcttttccatcctcttttccctcctcctcctcttcctcctcctcctcctgctatcctctaataccaagcaccccagaggaggtttctgctgatgatgagacaccaaatcctccccagagtgctcagatagcctgctcctccccctcggtcgttgcttcccttccattagatcaatctgatgagggctccagcagccaaaaggaggagagtccaagcaccctacaggtcctgccagacagtgagtctttacccagaagtgagatagatgaaaaggtgactgatttggtgcagtttctgctcttcaagtatcaaatgaaggagccgatcacaaaggcagaaatactggagagtgtcataaaaaattatgaagaccacttccctttgttgtttagtgaagcctccgagtgcatgctgctggtctttggcattgatgtaaaggaagtggatcccactggccactcctttgtccttgtcacctccctgggcctcacctatgatgggatgctgagtgatgtccagagcatgcccaagactggcattctcatacttatcctaagcataatcttcatagagggctactgcacccctgaggaggtcatctgggaagcactgaatatgatggggctgtatgatgggatggagcacctcatttatggggagcccaggaagctgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtgcctggcagtgatcctgcacggtatgagtttctgtggggtccaagggctcatgctgaaattaggaagatgagtctcctgaaatttttggccaaggtaaatgggagtgatccaagatccttcccactgtggtatgaggaggctttgaaagatgaggaagagagagcccaggacagaattgccaccacagatgatactactgccatggccagtgcaagttctagcgctacaggtagcttctcctaccctgaataa
Sequence Length
1110
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,780 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family A, 10, mRNA
NCBI Official Synonym Full Names
MAGE family member A10
NCBI Official Symbol
MAGEA10
NCBI Official Synonym Symbols
CT1.10; MAGE10
NCBI Protein Information
melanoma-associated antigen 10
UniProt Protein Name
Melanoma-associated antigen 10
UniProt Gene Name
MAGEA10
UniProt Synonym Gene Names
MAGE10; CT1.10
UniProt Entry Name
MAGAA_HUMAN

NCBI Description

This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream melanoma antigen family A, 5 (MAGEA5) gene.[provided by RefSeq, Oct 2011]

Uniprot Description

MAGE-A10: Not known, though may play a role in embryonal development and tumor transformation or aspects of tumor progression.

Chromosomal Location of Human Ortholog: Xq28

Research Articles on MAGEA10

Similar Products

Product Notes

The MAGEA10 magea10 (Catalog #AAA1272258) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcgag ctccaaagcg tcagcgctgc atgcctgaag aagatcttca atcccaaagt gagacacagg gcctcgaggg tgcacaggct cccctggctg tggaggagga tgcttcatca tccacttcca ccagctcctc ttttccatcc tcttttccct cctcctcctc ttcctcctcc tcctcctgct atcctctaat accaagcacc ccagaggagg tttctgctga tgatgagaca ccaaatcctc cccagagtgc tcagatagcc tgctcctccc cctcggtcgt tgcttccctt ccattagatc aatctgatga gggctccagc agccaaaagg aggagagtcc aagcacccta caggtcctgc cagacagtga gtctttaccc agaagtgaga tagatgaaaa ggtgactgat ttggtgcagt ttctgctctt caagtatcaa atgaaggagc cgatcacaaa ggcagaaata ctggagagtg tcataaaaaa ttatgaagac cacttccctt tgttgtttag tgaagcctcc gagtgcatgc tgctggtctt tggcattgat gtaaaggaag tggatcccac tggccactcc tttgtccttg tcacctccct gggcctcacc tatgatggga tgctgagtga tgtccagagc atgcccaaga ctggcattct catacttatc ctaagcataa tcttcataga gggctactgc acccctgagg aggtcatctg ggaagcactg aatatgatgg ggctgtatga tgggatggag cacctcattt atggggagcc caggaagctg ctcacccaag attgggtgca ggaaaactac ctggagtacc ggcaggtgcc tggcagtgat cctgcacggt atgagtttct gtggggtcca agggctcatg ctgaaattag gaagatgagt ctcctgaaat ttttggccaa ggtaaatggg agtgatccaa gatccttccc actgtggtat gaggaggctt tgaaagatga ggaagagaga gcccaggaca gaattgccac cacagatgat actactgcca tggccagtgc aagttctagc gctacaggta gcttctccta ccctgaataa. It is sometimes possible for the material contained within the vial of "MAGEA10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.