Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MACROD1 cdna clone

MACROD1 cDNA Clone

Gene Names
MACROD1; LRP16
Synonyms
MACROD1; MACROD1 cDNA Clone; MACROD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgaaggtggacctgagcacctccaccgactggaaggaggcgaaatcctttctgaagggcctgagtgacaagcagcgggaggaacattacttctgcaaggactttgtcaggctgaagaagatcccgacatggaaggagatggcgaaaggggtggctgtgaaggtggaggagcccaggtataaaaaggacaagcagctcaatgagaaaatctccctgctccgcagcgacatcaccaagctggaggtggacgccatcgtcaacgccgccaacagctccctgctcggaggcggtggcgtggacggctgcattcatcgggccgccggccccctgcttaccgacgagtgccggaccctgcagagctgtaagactggcaaggccaagatcaccggcggctatcggctcccggccaagtacgtcatccacacagtggggcccatcgcctacggggagcccagcgccagtcaggctgccgagctccgcagctgctacctgagcagtctggacctgctgctggagcaccggctccgctcggtggcgttcccctgcatctccaccggcgtgtttggctacccctgtgaggcggccgccgagatcgtgctggccacgctgcgagagtggctggagcagcacaaggacaaggtggaccggctgatcatctgcgtgttcctcgagaaggacgaggacatctaccggagccggctcccccactacttccccgtggcctga
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,505 Da
NCBI Official Full Name
Homo sapiens MACRO domain containing 1, mRNA
NCBI Official Synonym Full Names
MACRO domain containing 1
NCBI Official Symbol
MACROD1
NCBI Official Synonym Symbols
LRP16
NCBI Protein Information
O-acetyl-ADP-ribose deacetylase MACROD1
UniProt Protein Name
O-acetyl-ADP-ribose deacetylase MACROD1
UniProt Gene Name
MACROD1
UniProt Synonym Gene Names
LRP16
UniProt Entry Name
MACD1_HUMAN

Uniprot Description

MACROD1: Deacetylates O-acetyl-ADP ribose, a signaling molecule generated by the deacetylation of acetylated lysine residues in histones and other proteins. Plays a role in estrogen signaling. Binds to androgen receptor (AR) and amplifies the transactivation function of AR in response to androgen. May play an important role in carcinogenesis and/or progression of hormone-dependent cancers by feed-forward mechanism that activates ESR1 transactivation. Could be an ESR1 coactivator, providing a positive feedback regulatory loop for ESR1 signal transduction. Could be involved in invasive growth by down-regulating CDH1 in endometrial cancer cells. Enhances ESR1-mediated transcription activity. A chromosomal aberration involving MACROD1 is found in acute leukemia. Translocation t(11;21)(q13;q22) that forms a RUNX1-MACROD1 fusion protein.

Protein type: EC 3.5.1.-; Mitochondrial

Chromosomal Location of Human Ortholog: 11q11

Cellular Component: nucleus

Molecular Function: deacetylase activity; hydrolase activity, acting on glycosyl bonds; protein binding

Biological Process: protein amino acid de-ADP-ribosylation; purine nucleoside metabolic process; response to DNA damage stimulus

Research Articles on MACROD1

Similar Products

Product Notes

The MACROD1 macrod1 (Catalog #AAA1278889) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga aggtggacct gagcacctcc accgactgga aggaggcgaa atcctttctg aagggcctga gtgacaagca gcgggaggaa cattacttct gcaaggactt tgtcaggctg aagaagatcc cgacatggaa ggagatggcg aaaggggtgg ctgtgaaggt ggaggagccc aggtataaaa aggacaagca gctcaatgag aaaatctccc tgctccgcag cgacatcacc aagctggagg tggacgccat cgtcaacgcc gccaacagct ccctgctcgg aggcggtggc gtggacggct gcattcatcg ggccgccggc cccctgctta ccgacgagtg ccggaccctg cagagctgta agactggcaa ggccaagatc accggcggct atcggctccc ggccaagtac gtcatccaca cagtggggcc catcgcctac ggggagccca gcgccagtca ggctgccgag ctccgcagct gctacctgag cagtctggac ctgctgctgg agcaccggct ccgctcggtg gcgttcccct gcatctccac cggcgtgttt ggctacccct gtgaggcggc cgccgagatc gtgctggcca cgctgcgaga gtggctggag cagcacaagg acaaggtgga ccggctgatc atctgcgtgt tcctcgagaa ggacgaggac atctaccgga gccggctccc ccactacttc cccgtggcct ga. It is sometimes possible for the material contained within the vial of "MACROD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.