Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LZTS2 cdna clone

LZTS2 cDNA Clone

Gene Names
LZTS2; LAPSER1
Synonyms
LZTS2; LZTS2 cDNA Clone; LZTS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccattgtgcagactctgccagtgccactggagcctgctcctgaagctgccactgccccacaagctccagtcatgggtagtgtgagcagccttatctcaggccggccctgtcccggggggccagctcctccccgccaccacggccctcctgggcccaccttcttccgccagcaggatggcctgctacggggtggctatgaggcacaggagccgctgtgcccagctgtgccccctaggaaggctgtccctgtcaccagcttcacctacatcaatgaggacttccggacagagtcaccccccagcccaagcagtgatgttgaggatgcccgagagcagcgggcacacaatgcccacctccgcggcccaccaccaaagctcatccctgtctctggaaagctggagaagaacatggagaagatcctgatccgcccaacagccttcaagccagtgctgcccaaacctcgaggggctccgtccctgcctagcttcatgggtcctcgggccaccgggctgtctgggagccagggcagcctgacgcagctgtttgggggccctgcctcctcctcctcctcttcctcctcctcttcagctgctgacaaacccctggcatttagtggctgggccagtggctgcccatcagggacgctatccgactctggccgaaactcactgtccagcctgcccacctacagcaccggaggtgccgagccaaccaccagctccccaggcgggcacctgccttcccatggctctgggcgaggggcactgcctgggccagcccgaggggtccctactgggccctcccactcagacagtggccggtcctcctccagcaagagcacaggctccctagggggccgtttggctggggggcttttgggcagtggtactcgggcctcccctgacagcagctcctgtggggagcgctcaccaccacccccgcctccacctccttcggatgaggccctgctgcactgtgtcctggaaggaaagctccgagaccgggaggcagagcttcagcagctgcgggacagtctggacgagaatgaggctaccatgtgccaggcatacgaggagcggcagcggcactggcagcgagagcgtgaggccctgcgagaggactgtgcggcccaggcacagcgggcacagcgggcccaacagctgctgcagctgcaggtgttccagctgcagcaggagaagcggcaattgcaggatgacttcgcacagctgctgcaggagcgcgaacagctggagcggcgctgcgccaccttggagcgggagcagcgggagctcgggccgaggcttgaggagaccaagtgggaggtgtgccagaaatcaggcgagatctccctgctgaagcagcagctgaaagagtctcaggcagagctggtgcagaagggcagcgagctggtggctctgcgggtggcgctgcgggaggcccgtgctacgctgcgggtcagtgagggccgtgcgcggggtctacaggaggccgcccgagctcgggagctggagctggaagcctgttcccaggagctgcagcgacaccgccaggaagctgagcagctgcgggagaaagctgggcagttggatgctgaggcggccggactccgggagccccctgtgccacctgccaccgctgacccattcctcctggcggagagtgatgaggccaaagtgcagcgggcagcagccggggttgggggcagcttgcgggcccaggtggagcgattgcgggtggagctgcagcgggagcggcggcggggtgaggagcagcgggacagctttgagggggagcggctggcctggcaggcagagaaggagcaggtgatccgctaccagaagcagctgcagcacaactacatccagatgtaccggcgcaaccggcagctagagcaggagctgcagcagctcagcctggagctggaggcccgggagctcgctgacctgggcctggccgagcaggccccctgcatctgcctggaggagatcactgctactgagatctag
Sequence Length
2010
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,759 Da
NCBI Official Full Name
Homo sapiens leucine zipper, putative tumor suppressor 2, mRNA
NCBI Official Synonym Full Names
leucine zipper tumor suppressor 2
NCBI Official Symbol
LZTS2
NCBI Official Synonym Symbols
LAPSER1
NCBI Protein Information
leucine zipper putative tumor suppressor 2
UniProt Protein Name
Leucine zipper putative tumor suppressor 2
UniProt Gene Name
LZTS2
UniProt Synonym Gene Names
hLZTS2
UniProt Entry Name
LZTS2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the leucine zipper tumor suppressor family of proteins, which function in transcription regulation and cell cycle control. This family member can repress beta-catenin-mediated transcriptional activation and is a negative regulator of the Wnt signaling pathway. It negatively regulates microtubule severing at centrosomes, and is necessary for central spindle formation and cytokinesis completion. It is implicated in cancer, where it may inhibit cell proliferation and decrease susceptibility to tumor development. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

LZTS2: Negative regulator of katanin-mediated microtubule severing and release from the centrosome. Required for central spindle formation and the completion of cytokinesis. May negatively regulate axonal outgrowth by preventing the formation of microtubule bundles that are necessary for transport within the elongating axon. Negative regulator of the Wnt signaling pathway. Represses beta-catenin-mediated transcriptional activation by promoting the nuclear exclusion of beta-catenin. Belongs to the LZTS2 family.

Protein type: Nuclear export

Chromosomal Location of Human Ortholog: 10q24

Cellular Component: vesicle

Molecular Function: protein binding

Research Articles on LZTS2

Similar Products

Product Notes

The LZTS2 lzts2 (Catalog #AAA1277953) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccattg tgcagactct gccagtgcca ctggagcctg ctcctgaagc tgccactgcc ccacaagctc cagtcatggg tagtgtgagc agccttatct caggccggcc ctgtcccggg gggccagctc ctccccgcca ccacggccct cctgggccca ccttcttccg ccagcaggat ggcctgctac ggggtggcta tgaggcacag gagccgctgt gcccagctgt gccccctagg aaggctgtcc ctgtcaccag cttcacctac atcaatgagg acttccggac agagtcaccc cccagcccaa gcagtgatgt tgaggatgcc cgagagcagc gggcacacaa tgcccacctc cgcggcccac caccaaagct catccctgtc tctggaaagc tggagaagaa catggagaag atcctgatcc gcccaacagc cttcaagcca gtgctgccca aacctcgagg ggctccgtcc ctgcctagct tcatgggtcc tcgggccacc gggctgtctg ggagccaggg cagcctgacg cagctgtttg ggggccctgc ctcctcctcc tcctcttcct cctcctcttc agctgctgac aaacccctgg catttagtgg ctgggccagt ggctgcccat cagggacgct atccgactct ggccgaaact cactgtccag cctgcccacc tacagcaccg gaggtgccga gccaaccacc agctccccag gcgggcacct gccttcccat ggctctgggc gaggggcact gcctgggcca gcccgagggg tccctactgg gccctcccac tcagacagtg gccggtcctc ctccagcaag agcacaggct ccctaggggg ccgtttggct ggggggcttt tgggcagtgg tactcgggcc tcccctgaca gcagctcctg tggggagcgc tcaccaccac ccccgcctcc acctccttcg gatgaggccc tgctgcactg tgtcctggaa ggaaagctcc gagaccggga ggcagagctt cagcagctgc gggacagtct ggacgagaat gaggctacca tgtgccaggc atacgaggag cggcagcggc actggcagcg agagcgtgag gccctgcgag aggactgtgc ggcccaggca cagcgggcac agcgggccca acagctgctg cagctgcagg tgttccagct gcagcaggag aagcggcaat tgcaggatga cttcgcacag ctgctgcagg agcgcgaaca gctggagcgg cgctgcgcca ccttggagcg ggagcagcgg gagctcgggc cgaggcttga ggagaccaag tgggaggtgt gccagaaatc aggcgagatc tccctgctga agcagcagct gaaagagtct caggcagagc tggtgcagaa gggcagcgag ctggtggctc tgcgggtggc gctgcgggag gcccgtgcta cgctgcgggt cagtgagggc cgtgcgcggg gtctacagga ggccgcccga gctcgggagc tggagctgga agcctgttcc caggagctgc agcgacaccg ccaggaagct gagcagctgc gggagaaagc tgggcagttg gatgctgagg cggccggact ccgggagccc cctgtgccac ctgccaccgc tgacccattc ctcctggcgg agagtgatga ggccaaagtg cagcgggcag cagccggggt tgggggcagc ttgcgggccc aggtggagcg attgcgggtg gagctgcagc gggagcggcg gcggggtgag gagcagcggg acagctttga gggggagcgg ctggcctggc aggcagagaa ggagcaggtg atccgctacc agaagcagct gcagcacaac tacatccaga tgtaccggcg caaccggcag ctagagcagg agctgcagca gctcagcctg gagctggagg cccgggagct cgctgacctg ggcctggccg agcaggcccc ctgcatctgc ctggaggaga tcactgctac tgagatctag. It is sometimes possible for the material contained within the vial of "LZTS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.