LSM11 cdna clone
LSM11 cDNA Clone
Synonyms
LSM11; LSM11 cDNA Clone; LSM11 cdna clone
Sequence
atggaggagcgggagcggggggcgaggtcggctggcgccgggagccccgcgcgcccgcccagcccgcggctggatgtcagctctgacagcttcgacccgctgctggccctgtacgcgccccgcctgcctcccattccctaccccaatgccccctgcttcaacaacgtggcggagtacgagagcttcctcaggaccggagtccggggcggcgggcgcgggcgcgggcgggctcggggcgcggccgcgggctctggggttcccgccgcacccgggccctcgggcaggactcgtcgccgcccggacgcgcccgccccggaccccgagcgcatccagcgcctccgccgtctcatggtggccaaagaggaaggggacggggccgcaggagcgggccggaggggtccgggtcggagcaggaaggcgccacgcaacgtgctcacgcgaatgcccttgcacgaaggcagccctctgggtgaactccatcgctgtatccgtgagggggtgaaggtgaatgttcacatccgcactttcaagggacttcggggcgtctgtacaggcttccttgttgcattcgacaagttctggaatatggcacttactgatgtggatgagacctaccgaaaacctgtcctaggcaaagcatatgaacgggattcttcactgactctcactaggctatttgatcggctgaaacttcaagattcctccaagaaggaagcagattctaagtctgcagttgaagattccactctgtctagatactcacagacatccacttggaagttggcttcagtgtggggaagagcagacactggccggggctcacacaagcgttcccgctctgtcccttcttccctgcaggcctctgcaagggaggagtccaggtcagagctgtcagggaggactacacggacagacggctccagtgtgggaggtaccttttccagggctaccaccctttccagaggccagtcccgtaagaaaaagcgaaagcccaaagtggattaccagcaggtattcactcgacacataaatcagattttcattcgaggcgagaatgtcctgctggttcatcttgcacagtga
Sequence Length
1083
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,500 Da
NCBI Official Full Name
Homo sapiens LSM11, U7 small nuclear RNA associated, mRNA
NCBI Official Synonym Full Names
LSM11, U7 small nuclear RNA associated
NCBI Official Symbol
LSM11
NCBI Protein Information
U7 snRNA-associated Sm-like protein LSm11
UniProt Protein Name
U7 snRNA-associated Sm-like protein LSm11
Protein Family
UniProt Gene Name
LSM11
UniProt Entry Name
LSM11_HUMAN
Uniprot Description
LSM11: Component of the U7 snRNP complex that is involved in the histone 3'-end pre-mRNA processing. Increases U7 snRNA levels but not histone 3'-end pre-mRNA processing activity, when overexpressed. Required for cell cycle progression from G1 to S phases. Binds specifically to the Sm-binding site of U7 snRNA. Belongs to the snRNP Sm proteins family.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 5q33.3
Cellular Component: nucleoplasm; nucleus; telomerase holoenzyme complex
Molecular Function: protein binding
Biological Process: histone mRNA 3'-end processing; histone mRNA metabolic process; termination of RNA polymerase II transcription
Research Articles on LSM11
Similar Products
Product Notes
The LSM11 lsm11 (Catalog #AAA1270200) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagc gggagcgggg ggcgaggtcg gctggcgccg ggagccccgc gcgcccgccc agcccgcggc tggatgtcag ctctgacagc ttcgacccgc tgctggccct gtacgcgccc cgcctgcctc ccattcccta ccccaatgcc ccctgcttca acaacgtggc ggagtacgag agcttcctca ggaccggagt ccggggcggc gggcgcgggc gcgggcgggc tcggggcgcg gccgcgggct ctggggttcc cgccgcaccc gggccctcgg gcaggactcg tcgccgcccg gacgcgcccg ccccggaccc cgagcgcatc cagcgcctcc gccgtctcat ggtggccaaa gaggaagggg acggggccgc aggagcgggc cggaggggtc cgggtcggag caggaaggcg ccacgcaacg tgctcacgcg aatgcccttg cacgaaggca gccctctggg tgaactccat cgctgtatcc gtgagggggt gaaggtgaat gttcacatcc gcactttcaa gggacttcgg ggcgtctgta caggcttcct tgttgcattc gacaagttct ggaatatggc acttactgat gtggatgaga cctaccgaaa acctgtccta ggcaaagcat atgaacggga ttcttcactg actctcacta ggctatttga tcggctgaaa cttcaagatt cctccaagaa ggaagcagat tctaagtctg cagttgaaga ttccactctg tctagatact cacagacatc cacttggaag ttggcttcag tgtggggaag agcagacact ggccggggct cacacaagcg ttcccgctct gtcccttctt ccctgcaggc ctctgcaagg gaggagtcca ggtcagagct gtcagggagg actacacgga cagacggctc cagtgtggga ggtacctttt ccagggctac caccctttcc agaggccagt cccgtaagaa aaagcgaaag cccaaagtgg attaccagca ggtattcact cgacacataa atcagatttt cattcgaggc gagaatgtcc tgctggttca tcttgcacag tga. It is sometimes possible for the material contained within the vial of "LSM11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
