LRP12 cdna clone
LRP12 cDNA Clone
Gene Names
LRP12; ST7
Synonyms
LRP12; LRP12 cDNA Clone; LRP12 cdna clone
Sequence
atggcctgtcgctggagcacaaaagagtctccgcggtggaggtctgcgttgctcttgcttttcctcgctggggtgtacggaaatggtgctcttgcagaacattctgaaaatgtgcatatttcaggagtgtcaactgcttgtggagagactccagagcaaatacgagcaccaagtggcataatcacaagcccaggctggccttctgaatatcctgcaaaaatcaactgtagctggttcataagggcaaacccaggcgaaatcattactataagttttcaggattttgatattcaaggatccagaaggtgcaatttggactggttgacaatagaaacatacaagaatattgaaagttacagagcttgtggttccacaattccacctccgtatatctcttcacaagaccacatctggattaggtttcattcggatgacaacatctctagaaagggtttcagactggcatatttttcagggaaatctgaggaaccaaattgtgcttgtgatcagtttcgttgtggtaatggaaagtgtataccagaagcctggaaatgtaataacatggatgaatgtggagatagttccgatgaagagatctgtgccaaagaagcaaatcctccaactgctgctgcttttcaaccctgtgcttacaaccagttccagtgtttatcccgttttaccaaagtttacacttgcctccccgaatctttaaaatgtgatgggaacattgactgccttgacctaggagatgagatagactgtgatgtgccaacatgtgggcaatggctaaaatatttttatggtacttttaattctcccaattatccagacttttatcctcctggaagcaattgcacctggttaatagacactggtgatcaccgtaaagtcattttacgcttcactgactttaaacttgatggtactggttatggtgattatgtcaaaatatatgatggattagaggagaatccacacaagcttttgcgtgtgttgacagcttttgattctcatgcacctcttacagttgtttcttcttctggacagataagggtacatttttgtgctgataaagtgaatgctgcaaggggatttaatgctacttaccaagtagatgggttctgtttgccatgggaaataccctgtggaggtaactgggggtgttatactgagcagcagcgttgtgatgggtattggcattgcccaaatggaagggatgaaaccaattgtaccatgtgccagaaggaagaatttccatgttcccgaaatggtgtctgttatcctcgttctgatcgctgcaactaccagaatcattgcccaaatggctcagatgaaaaaaactgctttttttgccaaccaggaaatttccattgtaaaaacaatcgttgtgtgtttgaaagttgggtgtgtgattctcaagatgactgtggtgatggcagcgatgaagaaaattgcccagtaatcgtgcctacaagagtcatcactgctgccgtcatagggagcctcatctgtggcctgttactcgtcatagcattgggatgtacttgtaagctttattctctgagaatgtttgaaagaagatcatttgaaacacagttgtcaagagtggaagcagaattgttaagaagagaagctcctccctcgtatggacaattgattgctcagggtttaattccaccagttgaagattttcctgtttgttcacctaatcaggcttctgttttggaaaatctgaggctagcggtacgatctcagcttggatttacttcagtcaggcttcctatggcaggcagatcaagcaacatttggaaccgtatttttaattttgcaagatcacgtcattctgggtcattggctttggtctcagcagatggagatgaggttgtccctagtcagagtaccagtagagaacctgagagaaatcatactcacagaagtttgttttccgtggagtctgatgatacagacacagaaaatgagagaagagatatggcaggagcatctggtggggttgcagctcctttgcctcaaaaagtccctcccacaacggcagtagaagcgacagtaggagcatgtgcaagttcctcaactcagagtacccgaggtggtcatgcagataatggaagggatgtgacaagtgtggaacccccaagtgtgagtccagcacgtcaccagcttacaagtgcactcagtcgtatgactcaggggctacgctgggtacgttttacattaggacgatcaagttccctaagtcagaaccagagtcctttgagacaacttgataatggggtaagtggaagagaagatgatgatgatgttgaaatgctaattccaatttctgatggatcttcagactttgatgtgaatgactgctccagacctcttcttgatcttgcctcagatcaaggacaagggcttagacaaccatataatgcaacaaatcctggagtaaggccaagtaatcgagatggcccctgtgagcgctgtggtattgtccacactgcccagataccagacacttgcttagaagtaacactgaaaaacgaaacgagtgatgatgaggctttgttactttgttag
Sequence Length
2580
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
93,123 Da
NCBI Official Full Name
Homo sapiens low density lipoprotein-related protein 12, mRNA
NCBI Official Synonym Full Names
LDL receptor related protein 12
NCBI Official Symbol
LRP12
NCBI Official Synonym Symbols
ST7
NCBI Protein Information
low-density lipoprotein receptor-related protein 12
UniProt Protein Name
Low-density lipoprotein receptor-related protein 12
Protein Family
UniProt Gene Name
LRP12
UniProt Synonym Gene Names
ST7; LRP-12
UniProt Entry Name
LRP12_HUMAN
NCBI Description
This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Uniprot Description
LRP12: Probable receptor, which may be involved in the internalization of lipophilic molecules and/or signal transduction. May act as a tumor suppressor. Belongs to the LDLR family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 8q22.2
Cellular Component: integral to plasma membrane
Molecular Function: protein binding
Research Articles on LRP12
Similar Products
Product Notes
The LRP12 lrp12 (Catalog #AAA1277059) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctgtc gctggagcac aaaagagtct ccgcggtgga ggtctgcgtt gctcttgctt ttcctcgctg gggtgtacgg aaatggtgct cttgcagaac attctgaaaa tgtgcatatt tcaggagtgt caactgcttg tggagagact ccagagcaaa tacgagcacc aagtggcata atcacaagcc caggctggcc ttctgaatat cctgcaaaaa tcaactgtag ctggttcata agggcaaacc caggcgaaat cattactata agttttcagg attttgatat tcaaggatcc agaaggtgca atttggactg gttgacaata gaaacataca agaatattga aagttacaga gcttgtggtt ccacaattcc acctccgtat atctcttcac aagaccacat ctggattagg tttcattcgg atgacaacat ctctagaaag ggtttcagac tggcatattt ttcagggaaa tctgaggaac caaattgtgc ttgtgatcag tttcgttgtg gtaatggaaa gtgtatacca gaagcctgga aatgtaataa catggatgaa tgtggagata gttccgatga agagatctgt gccaaagaag caaatcctcc aactgctgct gcttttcaac cctgtgctta caaccagttc cagtgtttat cccgttttac caaagtttac acttgcctcc ccgaatcttt aaaatgtgat gggaacattg actgccttga cctaggagat gagatagact gtgatgtgcc aacatgtggg caatggctaa aatattttta tggtactttt aattctccca attatccaga cttttatcct cctggaagca attgcacctg gttaatagac actggtgatc accgtaaagt cattttacgc ttcactgact ttaaacttga tggtactggt tatggtgatt atgtcaaaat atatgatgga ttagaggaga atccacacaa gcttttgcgt gtgttgacag cttttgattc tcatgcacct cttacagttg tttcttcttc tggacagata agggtacatt tttgtgctga taaagtgaat gctgcaaggg gatttaatgc tacttaccaa gtagatgggt tctgtttgcc atgggaaata ccctgtggag gtaactgggg gtgttatact gagcagcagc gttgtgatgg gtattggcat tgcccaaatg gaagggatga aaccaattgt accatgtgcc agaaggaaga atttccatgt tcccgaaatg gtgtctgtta tcctcgttct gatcgctgca actaccagaa tcattgccca aatggctcag atgaaaaaaa ctgctttttt tgccaaccag gaaatttcca ttgtaaaaac aatcgttgtg tgtttgaaag ttgggtgtgt gattctcaag atgactgtgg tgatggcagc gatgaagaaa attgcccagt aatcgtgcct acaagagtca tcactgctgc cgtcataggg agcctcatct gtggcctgtt actcgtcata gcattgggat gtacttgtaa gctttattct ctgagaatgt ttgaaagaag atcatttgaa acacagttgt caagagtgga agcagaattg ttaagaagag aagctcctcc ctcgtatgga caattgattg ctcagggttt aattccacca gttgaagatt ttcctgtttg ttcacctaat caggcttctg ttttggaaaa tctgaggcta gcggtacgat ctcagcttgg atttacttca gtcaggcttc ctatggcagg cagatcaagc aacatttgga accgtatttt taattttgca agatcacgtc attctgggtc attggctttg gtctcagcag atggagatga ggttgtccct agtcagagta ccagtagaga acctgagaga aatcatactc acagaagttt gttttccgtg gagtctgatg atacagacac agaaaatgag agaagagata tggcaggagc atctggtggg gttgcagctc ctttgcctca aaaagtccct cccacaacgg cagtagaagc gacagtagga gcatgtgcaa gttcctcaac tcagagtacc cgaggtggtc atgcagataa tggaagggat gtgacaagtg tggaaccccc aagtgtgagt ccagcacgtc accagcttac aagtgcactc agtcgtatga ctcaggggct acgctgggta cgttttacat taggacgatc aagttcccta agtcagaacc agagtccttt gagacaactt gataatgggg taagtggaag agaagatgat gatgatgttg aaatgctaat tccaatttct gatggatctt cagactttga tgtgaatgac tgctccagac ctcttcttga tcttgcctca gatcaaggac aagggcttag acaaccatat aatgcaacaa atcctggagt aaggccaagt aatcgagatg gcccctgtga gcgctgtggt attgtccaca ctgcccagat accagacact tgcttagaag taacactgaa aaacgaaacg agtgatgatg aggctttgtt actttgttag. It is sometimes possible for the material contained within the vial of "LRP12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
