Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRP10 cdna clone

LRP10 cDNA Clone

Gene Names
LRP10; LRP9; LRP-10; MST087; MSTP087
Synonyms
LRP10; LRP10 cDNA Clone; LRP10 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgttggccaccctcctcctcctcctccttggaggcgctctggcccatccagaccggattatttttccaaatcatgcttgtgaggaccccccagcagtgctcttagaagtgcagggcaccttacagaggcccctggtccgggacagccgcacctcccctgccaactgcacctggctcatcctgggcagcaaggaacagactgtcaccatcaggttccagaagctacacctggcctgtggctcagagcgcttaaccctacgctcccctctccagccactgatctccctgtgtgaggcacctcccagccctctgcagctgcccgggggcaacgtcaccatcacttacagctatgctggggccagagcacccatgggccagggcttcctgctctcctacagccaagattggctgatgtgcctgcaggaagagtttcagtgcctgaaccaccgctgtgtatctgctgtccagcgctgtgatggggttgatgcctgtggcgatggctctgatgaagcaggttgcagctcagaccccttccctggcctgaccccaagacccgtcccctccctgccttgcaatgtcaccttggaggacttctatggggtcttctcctctcctggatatacacacctagcctcagtctcccacccccagtcctgccattggctgctggacccccatgatggccggcggctggccgtgcgcttcacagccctggacttgggctttggagatgcagtgcatgtgtatgacggccctgggccccctgagagctcccgactactgcgtagtctcacccacttcagcaatggcaaggctgtcactgtggagacactgtctggccaggctgttgtgtcctaccacacagttgcttggagcaatggtcgtggcttcaatgccacctaccatgtgcggggctattgcttgccttgggacagaccctgtggcttaggctctggcctgggagctggcgaaggcctaggtgagcgctgctacagtgaggcacagcgctgtgacggctcatgggactgtgctgacggcacagatgaggaggactgcccaggctgcccacctggacacttcccctgtggggctgctggcacctctggtgccacagcctgctacctgcctgctgaccgctgcaactaccagactttctgtgctgatggagcagatgagagacgctgtcggcattgccagcctggcaatttccgatgccgggacgagaagtgcgtgtatgagacgtgggtgtgcgatgggcagccagactgtgcggacggcagtgatgagtgggactgctcctatgttctgccccgcaaggtcattacagctgcagtcattggcagcctagtgtgcggcctgctcctggtcatcgccctgggctgcacctgcaagctctatgccattcgcacccaggagtacagcatctttgcccccctctcccggatggaggctgagattgtgcagcagcaggcacccccttcctacgggcagctcattgcccagggtgccatcccacctgtagaagactttcctacagagaatcctaatgataactcagtgctgggcaacctgcgttctctgctacagatcttacgccaggatatgactccaggaggtggcccaggtgcccgccgtcgtcagcggggccgcttgatgcgacgcctggtacgccgtctccgccgctggggcttgctccctcgaaccaacaccccggctcgggcctctgaggccagatcccaggtcacaccttctgctgctccccttgaggccctagatggtggcacaggtccagcccgtgagggcggggcagtgggtgggcaagatggggagcaggcacccccactgcccatcaaggctcccctcccatctgctagcacgtctccagcccccactactgtccctgaagccccagggccactgccctcactgcccctagagccatcactattgtctggagtggtgcaggccctgcgaggccgcctgttgcccagcctggggcccccaggaccaacccggagcccccctggaccccacacagcagtcctggccctggaagatgaggacgatgtgctactggtgccactggctgagccgggggtgtgggtagctgaggcagaggatgagccactgcttacctga
Sequence Length
2142
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,213 Da
NCBI Official Full Name
Homo sapiens low density lipoprotein receptor-related protein 10, mRNA
NCBI Official Synonym Full Names
LDL receptor related protein 10
NCBI Official Symbol
LRP10
NCBI Official Synonym Symbols
LRP9; LRP-10; MST087; MSTP087
NCBI Protein Information
low-density lipoprotein receptor-related protein 10
UniProt Protein Name
Low-density lipoprotein receptor-related protein 10
UniProt Gene Name
LRP10
UniProt Synonym Gene Names
LRP-10
UniProt Entry Name
LRP10_HUMAN

NCBI Description

This gene encodes a low density lipoprotein receptor family protein. A similar protein in mouse is thought to play a role in the uptake of apolipoprotein E-containing lipoproteins. [provided by RefSeq, Jul 2016]

Uniprot Description

LRP10: Probable receptor, which is involved in the internalization of lipophilic molecules and/or signal transduction. May be involved in the uptake of lipoprotein APOE in liver. Belongs to the LDLR family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: membrane

Research Articles on LRP10

Similar Products

Product Notes

The LRP10 lrp10 (Catalog #AAA1265636) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgttgg ccaccctcct cctcctcctc cttggaggcg ctctggccca tccagaccgg attatttttc caaatcatgc ttgtgaggac cccccagcag tgctcttaga agtgcagggc accttacaga ggcccctggt ccgggacagc cgcacctccc ctgccaactg cacctggctc atcctgggca gcaaggaaca gactgtcacc atcaggttcc agaagctaca cctggcctgt ggctcagagc gcttaaccct acgctcccct ctccagccac tgatctccct gtgtgaggca cctcccagcc ctctgcagct gcccgggggc aacgtcacca tcacttacag ctatgctggg gccagagcac ccatgggcca gggcttcctg ctctcctaca gccaagattg gctgatgtgc ctgcaggaag agtttcagtg cctgaaccac cgctgtgtat ctgctgtcca gcgctgtgat ggggttgatg cctgtggcga tggctctgat gaagcaggtt gcagctcaga ccccttccct ggcctgaccc caagacccgt cccctccctg ccttgcaatg tcaccttgga ggacttctat ggggtcttct cctctcctgg atatacacac ctagcctcag tctcccaccc ccagtcctgc cattggctgc tggaccccca tgatggccgg cggctggccg tgcgcttcac agccctggac ttgggctttg gagatgcagt gcatgtgtat gacggccctg ggccccctga gagctcccga ctactgcgta gtctcaccca cttcagcaat ggcaaggctg tcactgtgga gacactgtct ggccaggctg ttgtgtccta ccacacagtt gcttggagca atggtcgtgg cttcaatgcc acctaccatg tgcggggcta ttgcttgcct tgggacagac cctgtggctt aggctctggc ctgggagctg gcgaaggcct aggtgagcgc tgctacagtg aggcacagcg ctgtgacggc tcatgggact gtgctgacgg cacagatgag gaggactgcc caggctgccc acctggacac ttcccctgtg gggctgctgg cacctctggt gccacagcct gctacctgcc tgctgaccgc tgcaactacc agactttctg tgctgatgga gcagatgaga gacgctgtcg gcattgccag cctggcaatt tccgatgccg ggacgagaag tgcgtgtatg agacgtgggt gtgcgatggg cagccagact gtgcggacgg cagtgatgag tgggactgct cctatgttct gccccgcaag gtcattacag ctgcagtcat tggcagccta gtgtgcggcc tgctcctggt catcgccctg ggctgcacct gcaagctcta tgccattcgc acccaggagt acagcatctt tgcccccctc tcccggatgg aggctgagat tgtgcagcag caggcacccc cttcctacgg gcagctcatt gcccagggtg ccatcccacc tgtagaagac tttcctacag agaatcctaa tgataactca gtgctgggca acctgcgttc tctgctacag atcttacgcc aggatatgac tccaggaggt ggcccaggtg cccgccgtcg tcagcggggc cgcttgatgc gacgcctggt acgccgtctc cgccgctggg gcttgctccc tcgaaccaac accccggctc gggcctctga ggccagatcc caggtcacac cttctgctgc tccccttgag gccctagatg gtggcacagg tccagcccgt gagggcgggg cagtgggtgg gcaagatggg gagcaggcac ccccactgcc catcaaggct cccctcccat ctgctagcac gtctccagcc cccactactg tccctgaagc cccagggcca ctgccctcac tgcccctaga gccatcacta ttgtctggag tggtgcaggc cctgcgaggc cgcctgttgc ccagcctggg gcccccagga ccaacccgga gcccccctgg accccacaca gcagtcctgg ccctggaaga tgaggacgat gtgctactgg tgccactggc tgagccgggg gtgtgggtag ctgaggcaga ggatgagcca ctgcttacct ga. It is sometimes possible for the material contained within the vial of "LRP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.