Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRAT cdna clone

LRAT cDNA Clone

Gene Names
LRAT; LCA14
Synonyms
LRAT; LRAT cDNA Clone; LRAT cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaaccccatgctggaggtggtgtctttactactggagaagctgctcctcatctccaacttcacgctctttagttcgggcgccgcgggcgaagacaaagggaggaacagtttttatgaaaccagctctttccaccgaggcgacgtgctggaggtgccccggacccacctgacccactatggcatctacctaggagacaaccgtgttgcccacatgatgcccgacatcctgttggccctgacagacgacatggggcgcacgcagaaggtggtctccaacaagcgtctcatcctgggcgttattgtcaaagtggccagcatccgcgtggacacagtggaggacttcgcctacggagctaacatcctggtcaatcacctggacgagtccctccagaaaaaggcactgctcaacgaggaggtggcgcggagggctgaaaagctgctgggctttaccccctacagcctgctgtggaacaactgcgagcacttcgtgacctactgcagatatggcaccccgatcagtccccagtccgacaagttttgtgagactgtgaagataattattcgtgatcagagaagtgttcttgcttcagcagtcttgggattggcgtctatagtctgtacgggcttggtatcatacactacccttcctgcaatttttattccattcttcctatggatggctggctaa
Sequence Length
693
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,703 Da
NCBI Official Full Name
Homo sapiens lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase), mRNA
NCBI Official Synonym Full Names
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
NCBI Official Symbol
LRAT
NCBI Official Synonym Symbols
LCA14
NCBI Protein Information
lecithin retinol acyltransferase
UniProt Protein Name
Lecithin retinol acyltransferase
UniProt Gene Name
LRAT
UniProt Entry Name
LRAT_HUMAN

NCBI Description

The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]

Uniprot Description

LRAT: Transfers the acyl group from the sn-1 position of phosphatidylcholine to all-trans retinol, producing all-trans retinyl esters. Retinyl esters are storage forms of vitamin A. LRAT plays a critical role in vision. It provides the all-trans retinyl ester substrates for the isomerohydrolase which processes the esters into 11-cis-retinol in the retinal pigment epithelium; due to a membrane-associated alcohol dehydrogenase, 11 cis-retinol is oxidized and converted into 11-cis-retinaldehyde which is the chromophore for rhodopsin and the cone photopigments. Defects in LRAT are a cause of Leber congenital amaurosis type 14 (LCA14). It is a severe dystrophy of the retina, typically becoming evident in the first years of life. Visual function is usually poor and often accompanied by nystagmus, sluggish or near-absent pupillary responses, photophobia, high hyperopia and keratoconus. Belongs to the H-rev107 family.

Protein type: EC 2.3.1.135; Cofactor and Vitamin Metabolism - retinol; Transferase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 4q32.1

Cellular Component: endoplasmic reticulum membrane; multivesicular body; perinuclear region of cytoplasm; rough endoplasmic reticulum

Molecular Function: O-palmitoyltransferase activity; phosphatidylcholine-retinol O-acyltransferase activity; transferase activity, transferring acyl groups

Biological Process: retinoid metabolic process

Disease: Leber Congenital Amaurosis 14; Retinitis Pigmentosa

Research Articles on LRAT

Similar Products

Product Notes

The LRAT lrat (Catalog #AAA1276667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaacc ccatgctgga ggtggtgtct ttactactgg agaagctgct cctcatctcc aacttcacgc tctttagttc gggcgccgcg ggcgaagaca aagggaggaa cagtttttat gaaaccagct ctttccaccg aggcgacgtg ctggaggtgc cccggaccca cctgacccac tatggcatct acctaggaga caaccgtgtt gcccacatga tgcccgacat cctgttggcc ctgacagacg acatggggcg cacgcagaag gtggtctcca acaagcgtct catcctgggc gttattgtca aagtggccag catccgcgtg gacacagtgg aggacttcgc ctacggagct aacatcctgg tcaatcacct ggacgagtcc ctccagaaaa aggcactgct caacgaggag gtggcgcgga gggctgaaaa gctgctgggc tttaccccct acagcctgct gtggaacaac tgcgagcact tcgtgaccta ctgcagatat ggcaccccga tcagtcccca gtccgacaag ttttgtgaga ctgtgaagat aattattcgt gatcagagaa gtgttcttgc ttcagcagtc ttgggattgg cgtctatagt ctgtacgggc ttggtatcat acactaccct tcctgcaatt tttattccat tcttcctatg gatggctggc taa. It is sometimes possible for the material contained within the vial of "LRAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.