LINGO1 cdna clone
LINGO1 cDNA Clone
Gene Names
LINGO1; LERN1; LRRN6A; UNQ201
Synonyms
LINGO1; LINGO1 cDNA Clone; LINGO1 cdna clone
Sequence
atgctggcggggggcgtgaggagcatgcccagccccctcctggcctgctggcagcccatcctcctgctggtgctgggctcagtgctgtcaggctcggccacgggctgcccgccccgctgcgagtgctccgcccaggaccgcgctgtgctgtgccaccgcaagcgctttgtggcagtccccgagggcatccccaccgagacgcgcctgctggacctaggcaagaaccgcatcaaaacgctcaaccaggacgagttcgccagcttcccgcacctggaggagctggagctcaacgagaacatcgtgagcgccgtggagcccggcgccttcaacaacctcttcaacctccggacgctgggtctccgcagcaaccgcctgaagctcatcccgctaggcgtcttcactggcctcagcaacctgaccaagctggacatcagcgagaacaagatcgttatcctactggactacatgtttcaggacctgtacaacctcaagtcactggaggttggcgacaatgacctcgtctacatctctcaccgcgccttcagcggcctcaacagcctggagcagctgacgctggagaaatgcaacctgacctccatccccaccgaggcgctgtcccacctgcacggcctcatcgtcctgaggctccggcacctcaacatcaatgccatccgggactactccttcaagaggctgtaccgactcaaggtcttggagatctcccactggccctacttggacaccatgacacccaactgcctctacggcctcaacctgacgtccctgtccatcacacactgcaatctgaccgctgtgccctacctggccgtccgccacctagtctatctccgcttcctcaacctctcctacaaccccatcagcaccattgagggctccatgttgcatgagctgctccggctgcaggagatccagctggtgggcgggcagctggccgtggtggagccctatgccttccgcggcctcaactacctgcgcgtgctcaatgtctctggcaaccagctgaccacactggaggaatcagtcttccactcggtgggcaacctggagacactcatcctggactccaacccgctggcctgcgactgtcggctcctgtgggtgttccggcgccgctggcggctcaacttcaaccggcagcagcccacgtgcgccacgcccgagtttgtccagggcaaggagttcaaggacttccctgatgtgctactgcccaactacttcacctgccgccgcgcccgcatccgggaccgcaaggcccagcaggtgtttgtggacgagggccacacggtgcagtttgtgtgccgggccgatggcgacccgccgcccgccatcctctggctctcaccccgaaagcacctggtctcagccaagagcaatgggcggctcacagtcttccctgatggcacgctggaggtgcgctacgcccaggtacaggacaacggcacgtacctgtgcatcgcggccaacgcgggcggcaacgactccatgcccgcccacctgcatgtgcgcagctactcgcccgactggccccatcagcccaacaagaccttcgctttcatctccaaccagccgggcgagggagaggccaacagcacccgcgccactgtgcctttccccttcgacatcaagaccctcatcatcgccaccaccatgggcttcatctctttcctgggcgtcgtcctcttctgcctggtgctgctgtttctctggagccggggcaagggcaacacaaagcacaacatcgagatcgagtatgtgccccgaaagtcggacgcaggcatcagctccgccgacgcgccccgcaagttcaacatgaagatgatatga
Sequence Length
1845
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,146 Da
NCBI Official Full Name
Homo sapiens leucine rich repeat and Ig domain containing 1, mRNA
NCBI Official Synonym Full Names
leucine rich repeat and Ig domain containing 1
NCBI Official Symbol
LINGO1
NCBI Official Synonym Symbols
LERN1; LRRN6A; UNQ201
NCBI Protein Information
leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1
UniProt Protein Name
Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1
Protein Family
UniProt Gene Name
LINGO1
UniProt Synonym Gene Names
LERN1; LRRN6A
UniProt Entry Name
LIGO1_HUMAN
Uniprot Description
LINGO1: Functional component of the Nogo receptor signaling complex (RTN4R/NGFR) in RhoA activation responsible for some inhibition of axonal regeneration by myelin-associated factors. Is also an important negative regulator of oligodentrocyte differentiation and axonal myelination. Acts in conjunction with RTN4 and RTN4R in regulating neuronal precursor cell motility during cortical development. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 15q24.3
Cellular Component: plasma membrane
Molecular Function: epidermal growth factor receptor binding; protein binding
Biological Process: axonogenesis; negative regulation of axonogenesis; signal transduction
Research Articles on LINGO1
Similar Products
Product Notes
The LINGO1 lingo1 (Catalog #AAA1269300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggcgg ggggcgtgag gagcatgccc agccccctcc tggcctgctg gcagcccatc ctcctgctgg tgctgggctc agtgctgtca ggctcggcca cgggctgccc gccccgctgc gagtgctccg cccaggaccg cgctgtgctg tgccaccgca agcgctttgt ggcagtcccc gagggcatcc ccaccgagac gcgcctgctg gacctaggca agaaccgcat caaaacgctc aaccaggacg agttcgccag cttcccgcac ctggaggagc tggagctcaa cgagaacatc gtgagcgccg tggagcccgg cgccttcaac aacctcttca acctccggac gctgggtctc cgcagcaacc gcctgaagct catcccgcta ggcgtcttca ctggcctcag caacctgacc aagctggaca tcagcgagaa caagatcgtt atcctactgg actacatgtt tcaggacctg tacaacctca agtcactgga ggttggcgac aatgacctcg tctacatctc tcaccgcgcc ttcagcggcc tcaacagcct ggagcagctg acgctggaga aatgcaacct gacctccatc cccaccgagg cgctgtccca cctgcacggc ctcatcgtcc tgaggctccg gcacctcaac atcaatgcca tccgggacta ctccttcaag aggctgtacc gactcaaggt cttggagatc tcccactggc cctacttgga caccatgaca cccaactgcc tctacggcct caacctgacg tccctgtcca tcacacactg caatctgacc gctgtgccct acctggccgt ccgccaccta gtctatctcc gcttcctcaa cctctcctac aaccccatca gcaccattga gggctccatg ttgcatgagc tgctccggct gcaggagatc cagctggtgg gcgggcagct ggccgtggtg gagccctatg ccttccgcgg cctcaactac ctgcgcgtgc tcaatgtctc tggcaaccag ctgaccacac tggaggaatc agtcttccac tcggtgggca acctggagac actcatcctg gactccaacc cgctggcctg cgactgtcgg ctcctgtggg tgttccggcg ccgctggcgg ctcaacttca accggcagca gcccacgtgc gccacgcccg agtttgtcca gggcaaggag ttcaaggact tccctgatgt gctactgccc aactacttca cctgccgccg cgcccgcatc cgggaccgca aggcccagca ggtgtttgtg gacgagggcc acacggtgca gtttgtgtgc cgggccgatg gcgacccgcc gcccgccatc ctctggctct caccccgaaa gcacctggtc tcagccaaga gcaatgggcg gctcacagtc ttccctgatg gcacgctgga ggtgcgctac gcccaggtac aggacaacgg cacgtacctg tgcatcgcgg ccaacgcggg cggcaacgac tccatgcccg cccacctgca tgtgcgcagc tactcgcccg actggcccca tcagcccaac aagaccttcg ctttcatctc caaccagccg ggcgagggag aggccaacag cacccgcgcc actgtgcctt tccccttcga catcaagacc ctcatcatcg ccaccaccat gggcttcatc tctttcctgg gcgtcgtcct cttctgcctg gtgctgctgt ttctctggag ccggggcaag ggcaacacaa agcacaacat cgagatcgag tatgtgcccc gaaagtcgga cgcaggcatc agctccgccg acgcgccccg caagttcaac atgaagatga tatga. It is sometimes possible for the material contained within the vial of "LINGO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
