Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIG3 cdna clone

LIG3 cDNA Clone

Gene Names
LIG3; LIG2
Synonyms
LIG3; LIG3 cDNA Clone; LIG3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctttggctttcaagatcttctttccacaaaccctccgtgcactcagccgaaaagaactgtgcctattccgaaaacatcactggcgtgatgtaagacaattcagccagtggtcagaaacagatctgcttcatggacatcccctcttcctgagaagaaagcctgttctatcattccagggaagccatctaagatcacgtgccacctaccttgttttcttgccagggttgcatgtgggactctgcagtggcccctgtgagatggctgagcaacggttctgtgtggactatgccaagcgtggcacagctggctgcaaaaaatgcaaggaaaagattgtgaagggcgtatgccgaattggcaaagtggtgcccaatcccttctcagagtctgggggtgatatgaaagagtggtaccacattaaatgcatgtttgagaaactagagcgggcccgggccaccacaaaaaaaatcgaggacctcacagagctggaaggctgggaagagctggaagataatgagaaggaacagataacccagcacattgcagatctgtcttctaaggcagcaggtacaccaaagaagaaagctgttgtccaggctaagttgacaaccactggccaggtgacttctccagtgaaaggcgcctcatttgtcaccagtaccaatccccggaaattttctggcttttcagccaagcccaacaactctggggaagccccctcgagccccacccctaagagaagtctgtcttcaagcaaatgtgaccccaggcataaggactgtctgctacgggagtttcgaaagttatgcgccatggtggccgataatcctagctacaacacgaagacccagatcatccaggacttccttcggaaaggctcagcaggaggtgtggcatga
Sequence Length
900
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
95,802 Da
NCBI Official Full Name
Homo sapiens ligase III, DNA, ATP-dependent, mRNA
NCBI Official Synonym Full Names
DNA ligase 3
NCBI Official Symbol
LIG3
NCBI Official Synonym Symbols
LIG2
NCBI Protein Information
DNA ligase 3
UniProt Protein Name
DNA ligase 3
Protein Family
UniProt Gene Name
LIG3
UniProt Entry Name
DNLI3_HUMAN

NCBI Description

This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

LIG3: Interacts with DNA-repair protein XRCC1 and can correct defective DNA strand-break repair and sister chromatid exchange following treatment with ionizing radiation and alkylating agents. Belongs to the ATP-dependent DNA ligase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; EC 6.5.1.1

Chromosomal Location of Human Ortholog: 17q11.2-q12

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA ligase activity; protein binding

Biological Process: base-excision repair, DNA ligation; double-strand break repair; double-strand break repair via homologous recombination; lagging strand elongation; nucleotide-excision repair, DNA gap filling; transcription-coupled nucleotide-excision repair; V(D)J recombination

Research Articles on LIG3

Similar Products

Product Notes

The LIG3 lig3 (Catalog #AAA1277583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctttgg ctttcaagat cttctttcca caaaccctcc gtgcactcag ccgaaaagaa ctgtgcctat tccgaaaaca tcactggcgt gatgtaagac aattcagcca gtggtcagaa acagatctgc ttcatggaca tcccctcttc ctgagaagaa agcctgttct atcattccag ggaagccatc taagatcacg tgccacctac cttgttttct tgccagggtt gcatgtggga ctctgcagtg gcccctgtga gatggctgag caacggttct gtgtggacta tgccaagcgt ggcacagctg gctgcaaaaa atgcaaggaa aagattgtga agggcgtatg ccgaattggc aaagtggtgc ccaatccctt ctcagagtct gggggtgata tgaaagagtg gtaccacatt aaatgcatgt ttgagaaact agagcgggcc cgggccacca caaaaaaaat cgaggacctc acagagctgg aaggctggga agagctggaa gataatgaga aggaacagat aacccagcac attgcagatc tgtcttctaa ggcagcaggt acaccaaaga agaaagctgt tgtccaggct aagttgacaa ccactggcca ggtgacttct ccagtgaaag gcgcctcatt tgtcaccagt accaatcccc ggaaattttc tggcttttca gccaagccca acaactctgg ggaagccccc tcgagcccca cccctaagag aagtctgtct tcaagcaaat gtgaccccag gcataaggac tgtctgctac gggagtttcg aaagttatgc gccatggtgg ccgataatcc tagctacaac acgaagaccc agatcatcca ggacttcctt cggaaaggct cagcaggagg tgtggcatga. It is sometimes possible for the material contained within the vial of "LIG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.