LETM1 cdna clone
LETM1 cDNA Clone
Synonyms
LETM1; LETM1 cDNA Clone; LETM1 cdna clone
Sequence
atggcgtccatcttactgaggagctgccgcggccgggcgcccgcccgcctcccgccgccgcctcggtacaccgtcccgcggggtagtccaggggatcctgctcatctcagctgtgccagcaccctggggttgaggaactgcctgaatgttccatttggctgctgcactcccatccaccctgtgtacacatcctccagaggcgatcacctcggctgttgggctctgaggcccgagtgccttcgcatagtgtcgagagcgccatggacctctacctctgtgggttttgtggctgtgggacctcagtgccttcctgtgcgtggctggcactcttcgcgccctgttcgcgatgactcggtagtagagaagtccctcaagtccttgaaggacaagaacaagaagctggaggaaggcggcccggtgtacagcccccccgcagaggtggtggtgaagaagtccctggggcagcgggtgctggacgagctgaagcactactaccatggcttccgcctgctatggatcgacaccaagatcgcggcacgcatgctctggcgcatcctcaacggccacagcctgacccgccgggagcgcaggcagtttctccggatctgcgctgacctcttccgcctggtgccgttccttgtgttcgtggtggtgccgttcatggagtttctgctgcctgttgctgtgaagctcttccccaacatgttgccatccacatttgagactcagtcactcaaggaggagaggctgaagaaggagcttcgggtcaagctggagctggccaagttcctccaggacaccatcgaggagatggccttgaagaacaaggcagccaagggcagcgccaccaaagacttctctgtgtttttccagaagatccgggaaacaggggagaggcccagcaatgaggaaatcatgcgtttttccaaattatttgaggatgagctgaccctggacaacctgacacggccgcagctggtggccctgtgcaagctgctggagctacagtccatcggcaccaacaacttcctgcgcttccagcttaccatgcggctgcgctccataaaggcagacgacaagctgattgctgaggaaggggtggacagcctgaatgtcaaggagctgcaggcagcgtgtcgggcacgaggcatgcgggccctgggcgtcacggaagaccgcctgaggggtcagctgaagcagtggctggacctgcacctgcatcaggagatccccacatcgctgctcatcctgtcccgggccatgtacctcccggacaccctctctccagccgaccagctcaagtccacactgcagaccctcccagagattgtggcaaaggaagcacaggtgaaagtggccgaggtggagggcgagcaggtggacaacaaggccaagctggaggccacgctgcaggaggaggcggccatccagcaggagcaccgtgagaaggagctgcagaagcgctcggaggtggcgaaggattttgagcccgaacgtgtggtagctgctccccaaaggccggggaccgagccacagccagaaatgcctgacacagtcctgcagtcagagaccttgaaggacactgccccggtgctggagggcttgaaggaggaagagatcacgaaggaggaaatcgacatcctcagcgatgcctgctctaagctgcaggagcagaagaagtcactcaccaaggagaaggaggagctggagctgctgaaggaggatgtgcaggactacagcgaggacttgcaggagatcaagaaggaactttcaaagactggtgaagaaaaatacgtggaagaatctaaagccagcaagagattgacaaaaagggtgcagcaaatgatcgggcagatcgatggcttgatctcgcagctggagatggaccagcaggctggcaagctggccccggccaacggcatgcccacgggggagaacgtcatcagtgtcgctgagctcatcaacgccatgaagcaagtcaagcacattcccgaaagcaagctcaccagcctggccgcagcactggatgaaaacaaggatggcaaggtcaacatcgacgacctcgtcaaggtgattgagctggtggacaaagaagatgttcacatctccaccagccaggtggctgagattgtagcaacactggaaaaagaggagaaggtggaggagaaggagaaggccaaagagaaggcagagaaggaggtcgcagaggtgaagagctag
Sequence Length
2220
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,245 Da
NCBI Official Full Name
Homo sapiens leucine zipper-EF-hand containing transmembrane protein 1, mRNA
NCBI Official Synonym Full Names
leucine zipper and EF-hand containing transmembrane protein 1
NCBI Official Symbol
LETM1
NCBI Protein Information
LETM1 and EF-hand domain-containing protein 1, mitochondrial
UniProt Protein Name
LETM1 and EF-hand domain-containing protein 1, mitochondrial
Protein Family
UniProt Gene Name
LETM1
UniProt Entry Name
LETM1_HUMAN
NCBI Description
This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
Uniprot Description
LETM1: Crucial for the maintenance of mitochondrial tubular networks and for the assembly of the supercomplexes of the respiratory chain. Required for the maintenance of the tubular shape and cristae organization. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Mitochondrial; Calcium-binding; Membrane protein, integral
Chromosomal Location of Human Ortholog: 4p16.3
Cellular Component: mitochondrial inner membrane; mitochondrion
Molecular Function: protein binding
Biological Process: cristae formation
Disease: Wolf-hirschhorn Syndrome
Research Articles on LETM1
Similar Products
Product Notes
The LETM1 letm1 (Catalog #AAA1269484) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcca tcttactgag gagctgccgc ggccgggcgc ccgcccgcct cccgccgccg cctcggtaca ccgtcccgcg gggtagtcca ggggatcctg ctcatctcag ctgtgccagc accctggggt tgaggaactg cctgaatgtt ccatttggct gctgcactcc catccaccct gtgtacacat cctccagagg cgatcacctc ggctgttggg ctctgaggcc cgagtgcctt cgcatagtgt cgagagcgcc atggacctct acctctgtgg gttttgtggc tgtgggacct cagtgccttc ctgtgcgtgg ctggcactct tcgcgccctg ttcgcgatga ctcggtagta gagaagtccc tcaagtcctt gaaggacaag aacaagaagc tggaggaagg cggcccggtg tacagccccc ccgcagaggt ggtggtgaag aagtccctgg ggcagcgggt gctggacgag ctgaagcact actaccatgg cttccgcctg ctatggatcg acaccaagat cgcggcacgc atgctctggc gcatcctcaa cggccacagc ctgacccgcc gggagcgcag gcagtttctc cggatctgcg ctgacctctt ccgcctggtg ccgttccttg tgttcgtggt ggtgccgttc atggagtttc tgctgcctgt tgctgtgaag ctcttcccca acatgttgcc atccacattt gagactcagt cactcaagga ggagaggctg aagaaggagc ttcgggtcaa gctggagctg gccaagttcc tccaggacac catcgaggag atggccttga agaacaaggc agccaagggc agcgccacca aagacttctc tgtgtttttc cagaagatcc gggaaacagg ggagaggccc agcaatgagg aaatcatgcg tttttccaaa ttatttgagg atgagctgac cctggacaac ctgacacggc cgcagctggt ggccctgtgc aagctgctgg agctacagtc catcggcacc aacaacttcc tgcgcttcca gcttaccatg cggctgcgct ccataaaggc agacgacaag ctgattgctg aggaaggggt ggacagcctg aatgtcaagg agctgcaggc agcgtgtcgg gcacgaggca tgcgggccct gggcgtcacg gaagaccgcc tgaggggtca gctgaagcag tggctggacc tgcacctgca tcaggagatc cccacatcgc tgctcatcct gtcccgggcc atgtacctcc cggacaccct ctctccagcc gaccagctca agtccacact gcagaccctc ccagagattg tggcaaagga agcacaggtg aaagtggccg aggtggaggg cgagcaggtg gacaacaagg ccaagctgga ggccacgctg caggaggagg cggccatcca gcaggagcac cgtgagaagg agctgcagaa gcgctcggag gtggcgaagg attttgagcc cgaacgtgtg gtagctgctc cccaaaggcc ggggaccgag ccacagccag aaatgcctga cacagtcctg cagtcagaga ccttgaagga cactgccccg gtgctggagg gcttgaagga ggaagagatc acgaaggagg aaatcgacat cctcagcgat gcctgctcta agctgcagga gcagaagaag tcactcacca aggagaagga ggagctggag ctgctgaagg aggatgtgca ggactacagc gaggacttgc aggagatcaa gaaggaactt tcaaagactg gtgaagaaaa atacgtggaa gaatctaaag ccagcaagag attgacaaaa agggtgcagc aaatgatcgg gcagatcgat ggcttgatct cgcagctgga gatggaccag caggctggca agctggcccc ggccaacggc atgcccacgg gggagaacgt catcagtgtc gctgagctca tcaacgccat gaagcaagtc aagcacattc ccgaaagcaa gctcaccagc ctggccgcag cactggatga aaacaaggat ggcaaggtca acatcgacga cctcgtcaag gtgattgagc tggtggacaa agaagatgtt cacatctcca ccagccaggt ggctgagatt gtagcaacac tggaaaaaga ggagaaggtg gaggagaagg agaaggccaa agagaaggca gagaaggagg tcgcagaggt gaagagctag. It is sometimes possible for the material contained within the vial of "LETM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
